Toxoplasma gondii ribulose-5-phosphate isomerase TgRPI gene edited strain and application thereof
A technology of gene editing and Toxoplasma gondii, applied in the field of genetic engineering, can solve problems such as limited quantity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Construction of Example 1 Gene Knockout Strain
[0042] 1. Construction of CRISPR / Cas9 plasmid
[0043] Use the gRNA online design website (http: / / www.e-crisp.org / E-CRISP / designcrispr.html) to design the target gene TgRPI targeting site, according to the designed target sequence (GAAGAGACAAGAGAACTAAC, SEQ ID No. 7) Design gRNA upstream and downstream primers (as shown in Table 1). Using the pSAG1-Cas9-TgU6-sgMIC3 plasmid as a template, according to the NEB company Q5 point mutation kit ( Site-Directed MutagenesisKit) manual, the sgMIC3 in the above-mentioned template plasmid was replaced with the gRNA specific to the TgRPI gene target, and the pSAG1-Cas9-TgU6-sgTgRPI plasmid (sequence shown in SEQ ID NO: 1, wherein the 539th-558th base The base is the gRNA targeting sequence of the TgRPI gene, and the remaining bases are the plasmid backbone sequence amplified from the template plasmid pSAG1-Cas9-TgU6-sgMIC3), the specific method is as follows:
[0044] Table 1. Pri...
Embodiment 2
[0104] Example 2 Functional Verification of Gene Knockout Strains
[0105] (1) Plaque test
[0106]Human-derived fibroblast HFF cells were used to culture Toxoplasma gondii rpi-Dicre and Δrpi tachyzoites in vitro. When about 30% of the parasites escaped, the cells were scraped off with a disposable cell scraper, and the suspension was repeatedly blown with a 5mL syringe for 8-10 days. The second time, the vesicles were broken and the worms escaped, and the fresh overflowing Toxoplasma gondii tachyzoites were filtered, purified, and diluted with a sterilized 3 μm filter membrane, and the worms were counted with a cell counting plate; Inoculate worms into the 6-well plate and add 2% FBS DMEM medium (100Tg / well, do 3 parallels in each group), and inoculate the 6-well plate at 37°C, 5% CO 2 After cultured in the incubator for 7 days, observed under the microscope after 7 days, it was found that rpi-Dicre could form obvious plaques, and Δrpi could grow in HFF cells and form nanove...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com