Toxoplasma gondii ribulose-5-phosphate isomerase TgRPI gene edited strain and application thereof

A technology of gene editing and Toxoplasma gondii, applied in the field of genetic engineering, can solve problems such as limited quantity

Active Publication Date: 2022-03-11
SOUTH CHINA AGRI UNIV +1
View PDF8 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although genetic methods have been used to construct attenuated strains of Toxoplasma gondii, the number of potential attenuated live vaccines for Toxoplasma gondii is still very limited, and more potential vaccine design targets need to be screened to develop more candidate vaccines. Toxoplasma gondii vaccine strain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Toxoplasma gondii ribulose-5-phosphate isomerase TgRPI gene edited strain and application thereof
  • Toxoplasma gondii ribulose-5-phosphate isomerase TgRPI gene edited strain and application thereof
  • Toxoplasma gondii ribulose-5-phosphate isomerase TgRPI gene edited strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Construction of Example 1 Gene Knockout Strain

[0042] 1. Construction of CRISPR / Cas9 plasmid

[0043] Use the gRNA online design website (http: / / www.e-crisp.org / E-CRISP / designcrispr.html) to design the target gene TgRPI targeting site, according to the designed target sequence (GAAGAGACAAGAGAACTAAC, SEQ ID No. 7) Design gRNA upstream and downstream primers (as shown in Table 1). Using the pSAG1-Cas9-TgU6-sgMIC3 plasmid as a template, according to the NEB company Q5 point mutation kit ( Site-Directed MutagenesisKit) manual, the sgMIC3 in the above-mentioned template plasmid was replaced with the gRNA specific to the TgRPI gene target, and the pSAG1-Cas9-TgU6-sgTgRPI plasmid (sequence shown in SEQ ID NO: 1, wherein the 539th-558th base The base is the gRNA targeting sequence of the TgRPI gene, and the remaining bases are the plasmid backbone sequence amplified from the template plasmid pSAG1-Cas9-TgU6-sgMIC3), the specific method is as follows:

[0044] Table 1. Pri...

Embodiment 2

[0104] Example 2 Functional Verification of Gene Knockout Strains

[0105] (1) Plaque test

[0106]Human-derived fibroblast HFF cells were used to culture Toxoplasma gondii rpi-Dicre and Δrpi tachyzoites in vitro. When about 30% of the parasites escaped, the cells were scraped off with a disposable cell scraper, and the suspension was repeatedly blown with a 5mL syringe for 8-10 days. The second time, the vesicles were broken and the worms escaped, and the fresh overflowing Toxoplasma gondii tachyzoites were filtered, purified, and diluted with a sterilized 3 μm filter membrane, and the worms were counted with a cell counting plate; Inoculate worms into the 6-well plate and add 2% FBS DMEM medium (100Tg / well, do 3 parallels in each group), and inoculate the 6-well plate at 37°C, 5% CO 2 After cultured in the incubator for 7 days, observed under the microscope after 7 days, it was found that rpi-Dicre could form obvious plaques, and Δrpi could grow in HFF cells and form nanove...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a toxoplasma gondii ribulose-5-phosphate isomerase TgRPI gene edited strain and an application thereof. The invention discloses a potential vaccine and drug design target and a gene knockout strain for preventing toxoplasma gondii infection. The design target of the vaccine and the drug is a toxoplasma gondii ribulose-5-phosphate isomerase TgRPI gene, and the nucleotide sequence of the toxoplasma gondii ribulose-5-phosphate isomerase TgRPI gene is as shown in SEQ ID NO: 2. The TgRPI gene is knocked out of the gene knockout strain, the growth speed of the gene knockout strain in vitro is slowed down, but the gene knockout strain can be subcultured, and the gene knockout strain has the characteristics of small toxicity, less reproduction and the like in animal bodies, and can improve the immunocompetence of animals to toxoplasma gondii. The TgRPI plays an important role in in-vivo and in-vitro growth of toxoplasma gondii, so that the TgRPI has the potential of becoming a vaccine and a drug target, and the gene knockout strain has the potential of becoming an anti-toxoplasma gondii genetic engineering vaccine.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a gene deletion vaccine for preventing toxoplasma gondii infection, a preparation method and application thereof. Background technique [0002] Toxoplasma gondii is an obligate intracellular parasite belonging to the apicomplexa. It can infect almost all warm-blooded animals including humans and invade all nucleated cells. It is a very important zoonotic pathogen. Toxoplasma infection of pregnant women or pregnant animals can lead to miscarriage, stillbirth or deformed fetuses; AIDS infection and organ transplant patients and other immunocompromised or impaired groups can lead to acute respiratory failure, localized pneumonia, retinal choroid plexus, etc., severe can be fatal. Although there is an urgent need for the prevention and treatment of toxoplasmosis, there is no ideal drug or vaccine at present. Therefore, it is very important to screen potential vaccines ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/11C12N15/79A61K39/002A61P33/02C12R1/90
CPCC12N9/90C12N15/79A61K39/002A61P33/02C12N2800/30Y02A50/30
Inventor 冯耀宇夏宁波郭雪芳肖立华李娜郭亚琼元冬娟
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap