Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method and kit for detecting polymorphism of multiple single nucleotides and application thereof

A single nucleotide polymorphism and multiplex technology, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve the problem of limiting gene locus detection throughput and inconsistent copy number of single-stranded products , Inconsistent amplification efficiency and other issues, to achieve the effect of reducing reagent cost and detection cost, clear interpretation, and short detection time

Active Publication Date: 2022-05-13
郑州华之源医学检验实验室有限公司
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods have certain limitations. The signal difference between TaqMan probes in the hybridized state and the free state is small, especially when the probe length is longer, the signal difference is smaller, and it is difficult to distinguish from the background signal.
[0011] The technical principle of the traditional PCR melting curve technology is mostly to obtain single-stranded products, and then the probe and the single-stranded products form a melting curve to analyze the information of the target sequence. When this technology is applied to multiplex PCR amplification, different targets in the same reaction well The amplification efficiency of the sequence is inconsistent, especially the high GC template amplification problem, there is mutual competitive inhibition, so that the copy number of the single-stranded product of different target sequences is inconsistent, resulting in the detection sensitivity of different target sequences in the same reaction well is significantly different, limiting Gene loci detection throughput

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit for detecting polymorphism of multiple single nucleotides and application thereof
  • Method and kit for detecting polymorphism of multiple single nucleotides and application thereof
  • Method and kit for detecting polymorphism of multiple single nucleotides and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] This embodiment provides a method for detecting multiple single nucleotide polymorphisms, which is suitable for gene detection of individualized medications for chronic cardiovascular diseases such as hypertension, hyperglycemia, hyperlipidemia, warfarin, and clopidogrel, As well as fields with multiple single nucleotide polymorphism detection requirements such as tumor drug gene detection, deafness gene detection, and folic acid gene detection, the principle is as follows: figure 1 , figure 2 shown, including the following steps:

[0053] S1: According to the sequence of the target gene locus, design the specific upstream primer, downstream primer and probe sequence of each target gene locus; the probe sequence includes two adjacent single-labeled probes, that is, a 3' end labeled quencher The long probe P1 of the group, and the short probe P2 that is phosphorylated and blocked at the 3' end of the other adjacent 5' end of the fluorescent group, and the length of the...

Embodiment 2

[0058] The present embodiment provides a method for detecting hypertension drug-related genes on the basis of embodiment 1, and specifies the technical solution of embodiment 1. The specific steps of the method are as follows:

[0059] Step S1: According to the gene sequence of the five SNP sites of ACE (rs4646994), CYP2D6*10 (rs1065852), ADRB1 (rs1801253), AGTR1 (rs5186) and CYP2C9*3 (rs1057910), use MEGA4 software to perform sequence clastal W method comparison Yes, with the assistance of primer design software Primer Premier 5 and probe design software Primer Express3.0, specific detection primers and probe sets were designed. The relevant specific sequences are as follows:

[0060] Primer sequence:

[0061] ACEF1:TTTCTCTAGACCTGCTGCCTATAC,

[0062] ACER1:AGCTCAGAGAATTTCAGAGCTG,

[0063] CYP2D6*10F1: CCTCCCTCACCTGGTCGAAGC,

[0064] CYP2D6*10R1: TTCCTGCTCCTGGTGGACCTG,

[0065] ADRB1F1: GCCTTCAACCCCATCATCT,

[0066] ADRB1R1:GTCGTCGTCGTCGTCCGA,

[0067] AGTR1F1: TGAGTGACA...

Embodiment 3

[0102] This embodiment provides a kit for detecting multiple single nucleotide polymorphisms, namely human CYP2D6*10, CYP2C9*3, ADRB1(1165G>C), AGTR1(1166A>C), ACE(I / D) Detection kit (PCR-melting curve method), used for the detection of polymorphisms related to hypertension medication, including CYP2C9*3(rs1057910), AGTR1(rs180 1253), ACE(rs4646994), CYP2D6*10(rs1065852), ADRB1 (rs1801253) 5-fold PCR reaction solution, negative quality control product, positive quality control product, and contains 5 sets of primer-probe combinations in the following 1) to 5):

[0103] 1) Primers SEQ ID NO.1 to SEQ ID NO.2 and probe sequences SEQ ID NO.11 to SEQ ID NO.12 for detecting ACE (rs4646994), wherein the 3' end of the probe shown in SEQ ID NO.11 is labeled BHQ3, the 5' end of the probe shown in SEQ ID NO.12 is labeled with CY5, and the 3' end is phosphorylated;

[0104] 2) The primers SEQ ID NO.3 to SEQ ID NO.4 and the probe sequences SEQ ID NO.13 to SEQ ID NO.14 for detecting CYP2D6...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and a kit for detecting polymorphism of a plurality of single nucleotides and application of the method and the kit, and belongs to the technical field of gene detection.The method mainly comprises the steps that according to a target gene sequence, an upstream primer, a downstream primer and two adjacent single-labeled probes are designed, a multiplex PCR reaction system is prepared, amplification is conducted in a primer symmetric amplification mode, and a target gene sequence is obtained; and then melting curve analysis is carried out. According to the invention, the capability of distinguishing SNP alleles is enhanced by utilizing the fluorescence signal difference of two adjacent single-labeled probes and a target in a binding / dissociation state, so that the interpretation of multiple PCR is clearer. A single-chain amplification product is obtained in a primer symmetric amplification and rapid cooling mode, the amplification efficiency difference between multiple primer systems can be effectively reduced, and the high-GC template amplification problem is solved. The method breaks through the technical bottleneck of multiple single nucleotide polymorphism detection, and a multiple SNP detection method which is stable in result, simple in interpretation, high in flux, short in period and low in cost is provided for clinic.

Description

technical field [0001] The invention relates to the technical field of nucleic acid detection, in particular to a method for detecting multiple single nucleotide polymorphisms, a kit and applications thereof. Background technique [0002] Essential hypertension is one of the most common chronic diseases, and it is an important risk factor for cardiovascular diseases such as coronary heart disease and stroke. A large number of studies have proved that essential hypertension is mainly affected by genetic factors and environmental factors. Combined effect. Antihypertensive drugs commonly used clinically include diuretics, β-adrenoceptor blockers, calcium antagonists, ACE inhibitors, angiotensin II receptor antagonists and α-adrenoceptor blockers, however, in clinical Inter-individual variability in response to drugs for the treatment of hypertension is common, mainly due to genetic variation in drug-metabolizing enzymes and receptors associated with the drugs. At present, the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6858C12Q1/6883C12N15/11
CPCC12Q1/6858C12Q1/6883C12Q2600/156C12Q2600/16C12Q2600/106C12Q2531/113C12Q2537/143C12Q2527/107C12Q2563/107Y02A50/30
Inventor 童京京赵瑞瑞刘勋刘瑞娜李博茹
Owner 郑州华之源医学检验实验室有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com