Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for obtaining glyphosate-resistant rice by precisely editing endogenous EPSPS gene and system used by method

A glyphosate-resistant, editing system technology, applied in genetic engineering, plant genetic improvement, chemical instruments and methods, etc., can solve problems such as low efficiency, base substitution, and small fragment precise insertion and deletion without efficient methods

Pending Publication Date: 2022-06-07
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the efficiency of arbitrary gene replacement mediated by the homologous recombination repair pathway is still low in plant cells, and it is only feasible in a few laboratories (Li and Xia, 2019)
In addition, the single base editing system can only realize the conversion between bases, and there is no efficient method for base conversion and precise insertion and deletion of small fragments
The guided editing system that has emerged in recent years can achieve precise single-base substitutions (including transitions and toppings) and insertion of small fragments on genomic DNA without the help of DNA double-strand break gaps and exogenous donor repair templates. and deletion, which have great application prospects in precise genome modification, but the efficiency of this system in plant cells is currently low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for obtaining glyphosate-resistant rice by precisely editing endogenous EPSPS gene and system used by method
  • Method for obtaining glyphosate-resistant rice by precisely editing endogenous EPSPS gene and system used by method
  • Method for obtaining glyphosate-resistant rice by precisely editing endogenous EPSPS gene and system used by method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0084] Example 1. Obtaining glyphosate-resistant rice by precise editing of endogenous EPSPS gene

[0085] 1. Construction of precise editing vectors

[0086] 1.1. Overlapping PCR to obtain T2A-NLS-RAD52-NLS fragment

[0087] The first round PCR product (1378bp) was obtained by using the RAD52F1 / R1 primer for PCR amplification with the RAD52 plasmid (2306bp), which was codon-optimized and fully synthesized by Beijing Qingke Biotechnology Co., Ltd. as the template.

[0088] The first round primer sequences are as follows (5'→3'):

[0089] RAD52F1:GGAGGAGAATCCCCGGCCCTgtcgccaccATGGCCCCAAAGAAGAAGCGG;

[0090] RAD52R1: CTTCTTTTTCTTAGCCTGTCCGGC.

[0091] Using the first-round PCR product as a template, PCR amplification was performed using RAD52F2 / R2 primers to obtain a second-round PCR product (1431 bp).

[0092] The second round primer sequences are as follows (5'→3'):

[0093] RAD52F2:GCAGAGGAAGTCTGTTAACATGCGGTGACGTGGAGGAGAATCCCGGCCC;

[0094] RAD52R2: ctcagcctcgacgCTTAAGTC...

Embodiment 2

[0174] Example 2. Acquisition and genotype identification of transgenic rice

[0175] 2.1. Obtaining transgenic rice

[0176] Select plump Zhonghua 11 rice seeds (from the Institute of Crop Science, Chinese Academy of Agricultural Sciences), peel off the seed coats, sterilize and wash, and place them evenly into 2,4-D sterilized NB solid medium containing 2 mg / L, 28 Cultivation in the dark for about 30 days induces callus formation. After culturing the callus with NB solid medium containing 0.3M mannitol and 0.3M sorbitol (hereinafter referred to as hypertonic medium) for 4-6h, the plasmids prime editor-EPSPS and prime editor-Rad52-EPSPS of Example 1 The rice callus was bombarded with a gene gun, 0.6 μm gold powder was used, and the bombardment pressure was 900 psi. After bombardment, the cells were cultured on a hypertonic medium for 16 h and then transferred to the first round of NB selection medium (containing 2 mg / L of 2 mg / L). ,4-D, 50mg / L of hygromycin), cultured in th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for obtaining glyphosate-resistant rice by precisely editing an endogenous EPSPS gene and a system used by the method. According to the research, OsEPSPS is taken as a target gene, RAD52 and a guide editor are subjected to fusion expression through self-cleavage polypeptide T2A, a novel guide editing system is constructed, the editing efficiency of the guide editing system is improved by utilizing a method that RAD52 can promote chain exchange between genome DNA and homologous ssRNA, and a new technology and a new method are provided for accurate design and molecular breeding of crops. In addition, glyphosate is a herbicide which is most applied in the world, and has little harm to human, livestock and environment. The rice editing plant with high glyphosate herbicide resistance, which is obtained by the research, provides a new material for cultivating a novel rice germplasm with high glyphosate herbicide resistance, is expected to greatly improve the economical efficiency of rice production, and also provides a reference for obtaining other novel crop germplasm with high glyphosate herbicide resistance.

Description

technical field [0001] The invention belongs to the field of genetic engineering breeding, and particularly relates to a method for obtaining glyphosate-resistant rice by precisely editing an endogenous EPSPS gene and a system therefor. Background technique [0002] Site-directed modification of important crop genomes, including site-directed knockout of key genes, allele replacement, and site-directed integration of exogenous genes, will contribute to functional gene identification of important agronomic traits, analysis of regulatory networks for complex agronomic traits, and new research. Germplasm creation is of great significance to speed up the process of crop genetic improvement. In recent years, the establishment and utilization of CRISPR / Cas-mediated plant genome site-directed editing, single-base replacement and homologous recombination systems have played an important role in crop gene function research and precision breeding, showing broad development potential a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N9/10C07K19/00C12N15/82A01H5/00A01H6/46
CPCC12N9/1092C12Y205/01019C12N15/8275C07K2319/00
Inventor 夏兰琴李晶莹
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com