Method for obtaining glyphosate-resistant rice by precisely editing endogenous EPSPS gene and system used by method
A glyphosate-resistant, editing system technology, applied in genetic engineering, plant genetic improvement, chemical instruments and methods, etc., can solve problems such as low efficiency, base substitution, and small fragment precise insertion and deletion without efficient methods
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Example Embodiment
[0084] Example 1. Obtaining glyphosate-resistant rice by precise editing of endogenous EPSPS gene
[0085] 1. Construction of precise editing vectors
[0086] 1.1. Overlapping PCR to obtain T2A-NLS-RAD52-NLS fragment
[0087] The first round PCR product (1378bp) was obtained by using the RAD52F1 / R1 primer for PCR amplification with the RAD52 plasmid (2306bp), which was codon-optimized and fully synthesized by Beijing Qingke Biotechnology Co., Ltd. as the template.
[0088] The first round primer sequences are as follows (5'→3'):
[0089] RAD52F1:GGAGGAGAATCCCCGGCCCTgtcgccaccATGGCCCCAAAGAAGAAGCGG;
[0090] RAD52R1: CTTCTTTTTCTTAGCCTGTCCGGC.
[0091] Using the first-round PCR product as a template, PCR amplification was performed using RAD52F2 / R2 primers to obtain a second-round PCR product (1431 bp).
[0092] The second round primer sequences are as follows (5'→3'):
[0093] RAD52F2:GCAGAGGAAGTCTGTTAACATGCGGTGACGTGGAGGAGAATCCCGGCCC;
[0094] RAD52R2: ctcagcctcgacgCTTAAGTC...
Example Embodiment
[0174] Example 2. Acquisition and genotype identification of transgenic rice
[0175] 2.1. Obtaining transgenic rice
[0176] Select plump Zhonghua 11 rice seeds (from the Institute of Crop Science, Chinese Academy of Agricultural Sciences), peel off the seed coats, sterilize and wash, and place them evenly into 2,4-D sterilized NB solid medium containing 2 mg / L, 28 Cultivation in the dark for about 30 days induces callus formation. After culturing the callus with NB solid medium containing 0.3M mannitol and 0.3M sorbitol (hereinafter referred to as hypertonic medium) for 4-6h, the plasmids prime editor-EPSPS and prime editor-Rad52-EPSPS of Example 1 The rice callus was bombarded with a gene gun, 0.6 μm gold powder was used, and the bombardment pressure was 900 psi. After bombardment, the cells were cultured on a hypertonic medium for 16 h and then transferred to the first round of NB selection medium (containing 2 mg / L of 2 mg / L). ,4-D, 50mg / L of hygromycin), cultured in th...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap