Streptomyces albus pd9-pld3 and application thereof in production of epsilon-polylysine

A pd9-pld3, Streptomyces albicans technology, applied in microorganism-based methods, bacteria, microorganisms, etc., can solve problems such as limited yield, and achieve the effect of increasing yield and increasing stability

Active Publication Date: 2022-07-29
SHANGHAI QINGMEI GREEN FOOD +1
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to aim at the degradation of ε-polylysine due to the presence of ε-polylysine in the process of fermentative production of ε-polylysine by Streptomyces albulus Enzymes lead to the problem of limited production, so as to provide a modified genetically engineered bacterium to increase the production of ε-polylysine and reduce the activity of ε-polylysine degrading enzymes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Streptomyces albus pd9-pld3 and application thereof in production of epsilon-polylysine
  • Streptomyces albus pd9-pld3 and application thereof in production of epsilon-polylysine
  • Streptomyces albus pd9-pld3 and application thereof in production of epsilon-polylysine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1, the construction of genetically engineered bacteria

[0030] 1. Construction of p152-dCas9 inhibitory plasmid

[0031] Use the integrated plasmid pSET152 as the backbone of the p152-dCas9 suppressor plasmid, such as figure 1 As shown, the expression of the dCas9 gene in this plasmid is driven by the strong constitutive promoter ermE*p and terminated by the fd terminator; the sgRNA is transcribed from the promoter j23119 from E. coli and terminated by the TO terminator. The dCas9 gene is derived from the Cas9 nuclease with point mutations in the HNH domain and RuvC domain (D10A and H840A), respectively.

[0032] The 668-688bp of the target gene ε-poly-L-lysine degrading enzyme (pld) gene sequence was selected as the N20 sequence of the PAM site, the sequence is:

[0033] gggctgaccgcgttgatcac (SEQ IN NO: 1).

[0034] The primers for plasmid construction were designed as follows:

[0035] pld-dcas9-pam3F:

[0036] cctaggtataatactagtgggctgaccgcgttgatcacgt...

Embodiment 2

[0052] Example 2. Determination of ε-polylysine degrading enzyme enzymatic activity

[0053] Since the ε-polylysine degrading enzyme is located on the cell membrane, the fermentation broth of Streptomyces albulus pd9-pld3 obtained by the method of Example 1 was crushed to prepare a crude enzyme liquid, and ε-polylysine was added. Amino acid was used as the substrate, and the reaction was carried out at 30 °C and pH=7 for 60 min. The degradation amount of ε-polylysine was determined by HPLC to calculate the degradation rate, and the degradation rate was used to reflect the ε-polylysine. Relative activity of lysine-degrading enzymes.

[0054] The method for HPLC determination of ε-polylysine content is:

[0055] The fermentation broth obtained from the fermentation culture was sampled, centrifuged at 12,000 rpm for 15 minutes, the bacteria were separated, and filtered to obtain a clear filtrate; the filtrate was diluted to an appropriate number, and the production of ε-polylysi...

Embodiment 3

[0058] Embodiment 3, the formula optimization of shake flask fermentation experiment

[0059] The shake-flask fermentation recipe of Streptomyces albulus pd9-pld3 obtained by the method of Example 1 for producing ε-polylysine by shake-flask fermentation was optimized.

[0060] A large number of literatures show that the accumulation of ε-polylysine is closely related to pH during the fermentation of Streptomyces albicans. In the shake flask experiment, due to the inability to accurately control the pH, in order to avoid the rapid pH drop due to consumption of glucose by Streptomyces albicans, which will affect the accumulation and enrichment of the strain, and then affect the final production of ε-polylysine, we used Add CaCO to the medium 3 to slow down the rate of pH drop during shake flask fermentation.

[0061] Using Streptomyces albulus pd9-pld3 fermentation medium M3G as the starting medium, CaCO 3 The addition ratios were set to 0%, 0.2%, 0.5%, and 0.8%, respectively...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetically engineered bacterium of high-yield epsilon-polylysine, namely streptomyces albus pd9-pld3, and the preservation number of the genetically engineered bacterium is CCTCC (China Center for Type Culture Collection) M 20211549. The invention also discloses an application of the engineering bacterium in fermentation production of epsilon-polylysine, and an optimized fermentation culture medium for the streptomyces albus pd9-pld3, and also discloses an application of the engineering bacterium in fermentation production of epsilon-polylysine, and an optimized fermentation culture medium for the streptomyces albus pd9-pld3. The yield of the epsilon-polylysine of the streptomyces albus disclosed by the invention is obviously improved compared with that of an original strain, and the inhibition on an epsilon-polylysine degrading enzyme can be realized.

Description

technical field [0001] The invention relates to the technical field of industrial microorganisms, in particular to a genetically engineered bacterium - Streptomyces albulus pd9-pld3 and its application in the production of ε-polylysine. Background technique [0002] ε-polylysine (ε-poly-L-lysine) is a new type of biological preservative with high efficiency and broad spectrum. It is a polymer formed by linking the α-carboxyl and ε-amino groups of L-lysine. 25 to 35 lysine residues, the purified product is light yellow powder, easily soluble in water, strong hygroscopicity and slightly bitter taste. Compared with other preservatives, ε-polylysine has the characteristics of broad antibacterial spectrum, high antibacterial efficiency, good stability and high safety. ε-Polylysine has bacteriostatic effect on gram-positive bacteria, gram-negative bacteria, yeast and mold, and also has inhibitory effect on heat-resistant bacillus and some viruses; it is added in a small amount in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C12P13/02C12R1/47
CPCC12N1/20C12P13/02
Inventor俞宙汝赵志军李立史吉平李沁雨马新新袁辉沈沪铭
OwnerSHANGHAI QINGMEI GREEN FOOD