Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for knocking out TET2 gene of human bone marrow mesenchymal stem cell by using CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated 9) system

A bone marrow mesenchymal and TET2 technology, applied in the field of bioengineering, can solve the problems of high off-target rate and low efficiency, and achieve low off-target rate, strong specificity, complete and thorough effect

Pending Publication Date: 2022-07-29
朱文敏
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The object of the present invention is to provide a method for knocking out the TET2 gene of human bone marrow mesenchymal stem cells using the CRISPR-Cas9 system. The method of knocking out the TET2 gene of human bone marrow mesenchymal stem cells in the prior art has low efficiency and high off-target rate technical problems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for knocking out TET2 gene of human bone marrow mesenchymal stem cell by using CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated 9) system
  • Method for knocking out TET2 gene of human bone marrow mesenchymal stem cell by using CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated 9) system
  • Method for knocking out TET2 gene of human bone marrow mesenchymal stem cell by using CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated 9) system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Construction of CRISPR-Cas9 targeting vector

[0024] (1) Design gRNA for the target sequence

[0025] For the TET2 gene, open the website NCBI Pubmed, enter "target gene name: tet2, species: human" to obtain the genomic information of the target gene (gene name: TET2, gene ID number: 54790, gene details see https: / / www .ncbi.nlm.nih.gov / gene / 54790), determine the genomic sequence position of the target gene TET2, determine the position of the start codon ATG, download the genomic information of the target gene and name the file "TET2 geneome from Genebank". The TET2 partial genome sequence (SEQ ID NO: 1) was thus obtained: CAACCAAATG TCTCCGATTTGAGTGATAAG AAAGAATCTG TGAGTTCTGT AGCCCAAGAA AATGCAGTTA AAGATTTCAC CAGTTTTTCAACACATAACT.

[0026] Using Sanpgene software, open the above file and design a gRNA targeting exon 3 for the TET2 gene. The computer will automatically analyze the position of the gRNA on the gene sequence and the off-target (off-target) informa...

Embodiment 2

[0085] Example 2: Validation of CRISPR / Cas9 knockout efficiency in eukaryotic cells

[0086] (1) Plasmid amplification

[0087] 1) Take out 100 μL of E. coli competent cells (DH5α) from the -80°C ultra-low temperature freezer, put them on ice, and gently suspend the cells evenly after they are completely thawed;

[0088] 2) Add 1 μL of plasmids (lentiCRISPR v2-TET2-gRNA1, lentiCRISPR v2-TET2-gRNA2), mix gently, and place on ice for 30 minutes;

[0089] 3) Heat shock in a water bath at 42°C for 60s, and place on ice for 2min;

[0090] 4) Add 1mL LB / tube and operate in the ultra-clean workbench;

[0091] 5) Shake the bacteria for 30min, centrifuge to separate the supernatant and sediment;

[0092] 6) Discard 800 μL of the supernatant, and mix the rest to spread on the ampicillin plate;

[0093] 7) The plate was placed forward at 37°C for 10 minutes to absorb excess liquid, and then inverted overnight (about 12h);

[0094] 8) Pick a single colony from the ampicillin culture ...

Embodiment 3

[0137] Example 3: Construction of TET2 knockout human bone marrow mesenchymal stem cell line and identification of knockout effect

[0138] (1) Preparation of passaged cells:

[0139] 1) This study was approved by the Ethics Committee of Tongji University School of Medicine and Tongji Hospital. #1, #2 and #3 bone marrow mesenchymal stem cells (MSCs) were isolated from patients undergoing fracture surgery without acute systemic disease, malignancy or endocrine disorders.

[0140] 2) Culture MSCs cells in complete medium at 37°C with 5% CO 2 , and passaged when the cells reached 90% confluency. MSCs complete medium: 10% FBS+DMEM / F-12+NEAA or BMSCs complete medium purchased from Cyagen, the product number is HUXMA-90011.

[0141]3) Use 0.25% trypsin to digest cells for passage plating: 12mL of cell suspension (3x10 6 ) were evenly plated into 6-well plates, and the cells were ready for transfection the next day when the cells reached 70-90% confluence.

[0142] (2) Cell tran...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for knocking out a TET2 gene of a human bone marrow mesenchymal stem cell by using a CRISPR-Cas9 system, which comprises the following steps: designing a CRISPR-Cas9 target sequence aiming at a TET2 gene segment as shown in SEQ ID NO: 1, then synthesizing a target sequence with a joint and a complementary sequence thereof, carrying out annealing treatment to obtain two gRNA double-stranded DNA segments as insertion segments, respectively cloning the two insertion segments into lentiCRISPR v2 vectors, and carrying out knockout on the lentiCRISPR v2 vectors to obtain the TET2 gene knockout of the human bone marrow mesenchymal stem cell by using the lentiCRISPR v2 vectors. The method comprises the following steps of: obtaining plasmids, namely lentiCRISPR v2-TET2-gRNA1 and lentiCRISPR v2-TET2-gRNA2, which are used for targeting two different sites of the TET2 gene; transfecting human bone marrow mesenchymal stem cells with the plasmids, culturing for 24 hours, and treating the cells with puromycin for drug screening; adherent cells obtained after puromycin drug screening are treated into cell suspension, and cell genome DNA is extracted for identification. According to the method, relatively high MSCs cell TET2 gene knockout efficiency can be realized.

Description

technical field [0001] The invention belongs to the field of bioengineering and relates to human bone marrow mesenchymal stem cells, in particular to a method for knocking out the TET2 gene of human bone marrow mesenchymal stem cells by using a CRISPR-Cas9 system. Background technique [0002] Mesenchymal stem cells (MSCs) exist in bone marrow, fat, umbilical cord, peripheral blood, gingiva and other tissues, and have the ability to differentiate into mesodermal and ectodermal lineages. Mesenchymal stem cells can participate in processes such as angiogenesis and tissue repair through paracrine means. Spinal cord injury, multiple sclerosis, lupus erythematosus, amyotrophic lateral sclerosis, organ fibrosis, diabetic nephropathy, etc. Among them, bone marrow-derived mesenchymal stem cells have more excellent properties and are ideal seed cells. However, there are certain problems in its clinical application. With the increase of the age of the donor, or the increase of the n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N5/10C12N15/113C12Q1/686G01N33/573C12R1/91
CPCC12N15/85C12N15/1137C12N5/0663C12N9/0071C12Y114/11C12Q1/686G01N33/573C12R2001/91C12N2800/107C12N2510/00G01N2333/90245C12N2310/20C12Q2565/125
Inventor 孙毅朱文敏
Owner 朱文敏
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com