Unlock instant, AI-driven research and patent intelligence for your innovation.

Process for preparing human muscle hemoglobin by gene recombination

A human myoglobin, gene recombination technology, applied in the field of gene recombination, can solve the problems of wrong amino acid sequence, low expression efficiency, incomplete expression product, etc. Effect

Inactive Publication Date: 2004-08-04
王桂琴 +2
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Due to the limited extraction of tissue myoglobin and the low molecular weight of the molecule, it is very difficult to obtain a large amount of myoglobin
After retrieval, the American Medical Index [Natl.Acad.Sci.USA.1985; 82:5681-5684] (record number 06196066) has recorded the research on the recombinant expression of the human myoglobin gene, which uses lambda phage, pAS1 plasmid, etc. The cloning vector needs to undergo 4 times of recombination and is expressed in Escherichia coli in the form of fusion protein, but the translation region of recombinant myoglobin produced by it is only 390bp (462bp in the gene bank), the expression product is incomplete, and the amino acid sequence Incorrect, complex operation, and low expression efficiency
U.S. Patent No. 5,888,766 also discloses a method for preparing human myoglobin through gene recombination technology, but the required human myoglobin gene is obtained by chemical synthesis with a DNA synthesizer, and then modified and recombined with the carrier , it uses a tryptophan promoter plasmid and Escherichia coli JM109 as a vector for recombinant expression. From the analysis of its DNA sequence and the amino acid sequence of the expressed protein, 8 amino acids are inconsistent with the records in the literature and Genebank (Genebank)
However, most of the methods related to the preparation of myoglobin in China are directly extracted and purified from tissues with physical and chemical methods, and the literature on the preparation of human myoglobin by gene recombination expression has not yet been reported.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Process for preparing human muscle hemoglobin by gene recombination
  • Process for preparing human muscle hemoglobin by gene recombination
  • Process for preparing human muscle hemoglobin by gene recombination

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0015] 1. Amplification of myoglobin cDNA by RT-PCR

[0016] Total RNA was extracted from fresh skeletal muscle with Trizol and other reagents, the concentration and purity of RNA were determined by UV spectrophotometer, and the integrity of RNA was identified by denaturing agarose gel electrophoresis. Use the extracted total RNA to reverse transcribe into cDNA, use this as a template, add internal control β-actin, myoglobin upstream and downstream primers for PCR amplification, the sequence of the added Mb upstream and downstream primers is:

[0017] P1 5'AACG CGGATCC ATGGGGCTCAGCGACGGGGA 3' (BamH I)

[0018] P2 5'ATCGG CTCGAG GGTGGGGGTGGGAGCGGCA 3'(Xho I) amplification reaction parameters: denaturation: 94°C for 2min, annealing: 63°C for 30s, extension: 70°C for 45s, for 35 cycles. Amplified products were identified by 1.5% agarose gel electrophoresis (results in figure 1) And sent to Shanghai Sangong Bioengineering Company for DNA sequence determination (results see ...

Embodiment 2

[0027] This example is the same as Example 1 except for the amplification reaction parameters. The amplification reaction parameters in this example are: denaturation: 94°C for 1min, annealing: 60°C for 45s, extension: 68°C for 30s for 5 cycles, denaturation: 94°C for 1min, annealing: 65°C for 45s, extension: 68°C for 30s 30 cycles. The DNA amplification result and expression effect of this embodiment are exactly the same as those of Example 1

Embodiment 3

[0029] The amplification reaction parameters of this embodiment are different from other embodiments. The amplification reaction parameters are: denaturation: 94°C for 3min, annealing: 68°C for 60s, extension: 72°C for 60s, for 35 cycles. This embodiment has the same results and effects as other embodiments.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The gene recombination method of preparing human muscle hemoglobin includes RT-PCR process of preparing human muscle hemoglobin gene cDNA, recombinant expression plasmid constituting process, and the process of introducing recombinant into host colibacillus and expressing the foreign gene in the transformant. The plasmid for the transformant is pET-21A(+) and the colibacillus for the transforment is BL21DE3 bacteria strain. At the two ends of the inserted gene segment, there are designed artificial joints for double enzyme incision site for correct insertion and completing the constitution of recombinant in one step. Compared with available technology, the present invention has short preparation period and efficient expression product.

Description

technical field [0001] The invention relates to gene recombination technology, which is related to the artificial preparation of a large amount of human myoglobin, specifically a method for preparing human myoglobin by gene recombination technology. Background technique [0002] Human myoglobin (Mb) is composed of a peptide chain with a molecular weight of 17.8Kda and contains a heme. It exists in human cardiac muscle and skeletal muscle as a carrier of oxygen storage, and is one of the main proteins in cardiac muscle and skeletal muscle. The human myoglobin gene has been recorded in relevant literature and gene bank (Genebank), its full length is 10.4Kb, consists of 3 exons and 2 introns, and contains 70bp at the 5' and 3' ends respectively and 531bp untranslated region sequence [AkaboshiE. Cloning of the human myoglobin gene. Gene, 1985; 33: 241-249; WellerP, Jeffreys AJ, Wilson V & Blanchetot A. Organization of the human myoglobin gene. The EMBO. 1984; 3(2) : 439-446]. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/805C12N1/21C12N15/12C12N15/63C12N15/70C12Q1/68
Inventor 王桂琴陈明史沁卫
Owner 王桂琴