Process for preparing human muscle hemoglobin by gene recombination
A human myoglobin, gene recombination technology, applied in the field of gene recombination, can solve the problems of wrong amino acid sequence, low expression efficiency, incomplete expression product, etc. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0015] 1. Amplification of myoglobin cDNA by RT-PCR
[0016] Total RNA was extracted from fresh skeletal muscle with Trizol and other reagents, the concentration and purity of RNA were determined by UV spectrophotometer, and the integrity of RNA was identified by denaturing agarose gel electrophoresis. Use the extracted total RNA to reverse transcribe into cDNA, use this as a template, add internal control β-actin, myoglobin upstream and downstream primers for PCR amplification, the sequence of the added Mb upstream and downstream primers is:
[0017] P1 5'AACG CGGATCC ATGGGGCTCAGCGACGGGGA 3' (BamH I)
[0018] P2 5'ATCGG CTCGAG GGTGGGGGTGGGAGCGGCA 3'(Xho I) amplification reaction parameters: denaturation: 94°C for 2min, annealing: 63°C for 30s, extension: 70°C for 45s, for 35 cycles. Amplified products were identified by 1.5% agarose gel electrophoresis (results in figure 1) And sent to Shanghai Sangong Bioengineering Company for DNA sequence determination (results see ...
Embodiment 2
[0027] This example is the same as Example 1 except for the amplification reaction parameters. The amplification reaction parameters in this example are: denaturation: 94°C for 1min, annealing: 60°C for 45s, extension: 68°C for 30s for 5 cycles, denaturation: 94°C for 1min, annealing: 65°C for 45s, extension: 68°C for 30s 30 cycles. The DNA amplification result and expression effect of this embodiment are exactly the same as those of Example 1
Embodiment 3
[0029] The amplification reaction parameters of this embodiment are different from other embodiments. The amplification reaction parameters are: denaturation: 94°C for 3min, annealing: 68°C for 60s, extension: 72°C for 60s, for 35 cycles. This embodiment has the same results and effects as other embodiments.
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 