Gibberella gene engineering bacterium and its preparation and application

A technology of genetically engineered bacteria and gibberellin, applied in the field of genetic engineering, can solve the problems of time-consuming and labor-intensive results, little potential, and unclear goals, and achieve the effects of high efficiency, strong ability, and clear breeding goals

Inactive Publication Date: 2006-11-22
ZHEJIANG UNIV OF TECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the traditional strain breeding method mainly relies on random physical and chemical mutagenesis, the target is not clear, time-consuming and laborious, and the effect is not obvious
At present, the use of these methods to improve the ability of gibberellin synthesis by gibberella fujikura has been very limited, and the potential is not great

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gibberella gene engineering bacterium and its preparation and application
  • Gibberella gene engineering bacterium and its preparation and application
  • Gibberella gene engineering bacterium and its preparation and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Embodiment 1: Construction of overexpression vector

[0055] step:

[0056] (1) The strong promoter PgPd was amplified by PCR from the plasmid pAN7-1 (Punt et al.1987Gene56:117-124), and cloned into the vector pCB1004 (Carroll et al.1994Fungal Genet. Newsl.41:22) to form the recombinant plasmid pCB1004Pgpd. The strong promoter Pgpd can also be derived from any other DNA containing this sequence or synthesized directly. In addition to Pgpd, promoters constitutively expressed in filamentous fungi such as PtrpC can also be used. In addition to pCB1004, plasmids used to construct cps / ks gene overexpression vectors can also be expressed in filamentous fungi, such as pCSN43, pCSN44, pCB1004, pCB1003, pSH75, pMYX100, pMSN1 and pAN26.

[0057] (2) Design primers (forward primer: GG) according to the sequence of the gibberellin synthase gene cps / ks (GeneBank accession number: AJ810802) of G. GGATCC GCCGTACGTATGAAACACACCT, the underlined sequence is the cutting site of restr...

Embodiment 2

[0059] Embodiment 2: Construction of overexpression vector

[0060] step:

[0061] (1) The strong promoter PtrpC was amplified by PCR from the plasmid PZPnat1, and cloned into the corresponding site of the vector pBARKS1 by the restriction enzyme XbaI / BamHI to form the recombinant plasmid pBARtrpC.

[0062] (2) Design primers (forward primer: GG) according to the sequence of the gibberellin synthase gene cps / ks (GeneBank accession number: AJ810802) of G. GGATCC GCCGTACGTATGAAACACACCT, the underlined sequence is the cutting site of restriction enzyme BamH I; reverse primer: CC CTCGAG TACATATCAAA TTACCAGCT, the underlined sequence is the cutting point of restriction enzyme Xho I), and the sequence of the coding region was amplified by PCR technique. PCR reaction conditions: denaturation at 94°C for 5 min; followed by 32 cycles with parameters of 94°C for 1 min; 55°C for 30 sec and 72°C for 2 min; and finally extension at 72°C for 5 min.

[0063] (3) After the PCR product wa...

Embodiment 3

[0064] Embodiment 3: the acquisition of engineering bacteria

[0065] step:

[0066] (1) Inoculate Gibberella fujikura onto a PDA medium plate and cultivate at 24°C for 10 days;

[0067] (2) The spores were washed with sterile water, transferred to 100 mL of YpSs liquid medium, and cultured with shaking at 24°C and 200 rpm for 36 hours;

[0068] (3) Centrifuge at 4000rpm for 5 minutes after the culture solution is filtered to obtain spore precipitation, and wash three times with sterile deionized water;

[0069] (4) Suspend the spores with 200 μl of 0.1M lithium acetate solution;

[0070] (5) Take 5 μl of the plasmid pCBcps obtained in Example 1 (concentration 2 μg / μl), add it to the spore suspension, then add spermidine to make the final concentration 4 mM, and incubate at 4° C. for 30 minutes;

[0071] (6) Add 150 μl of 0.1 M lithium acetate solution of 40% PEG8000, and continue to incubate at 4° C. for 1 hour;

[0072] (7) Heat shock in a water bath at 37°C for 5 minute...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a gibberellin genetically engineered bacterium, which is obtained by the following method: respectively amplifying the rate-limiting enzyme gene cps / ks and the strong promoter Pgpd synthesized by gibberellin by PCR technology or PtrpC, and clone them into the corresponding sites of the target plasmids that can be expressed in filamentous fungi to obtain a cps / ks gene overexpression vector driven by a strong promoter, and then transform the overexpression vector into Gibberella to obtain the obtained The gibberellin genetically engineered bacteria described above. The invention utilizes the genetic engineering technology to improve the gibberellin, and the breeding target is clear and the efficiency is high; the ability of the obtained engineering bacterium to synthesize the gibberellin is strong, which is more than 40% higher than that of the starting gibberellin strain of the engineering bacterium.

Description

(1) Technical field [0001] The invention provides a gibberellin genetic engineering bacterium capable of producing gibberellin and its preparation and application, belonging to the field of genetic engineering. (2) Background technology [0002] Gibberellins (Gibberellins, GAs) is a plant growth regulator, which plays a very important role in plant growth and development. It can promote the internode elongation of plants, relieve the dormancy of seeds, tubers and buds, promote flowering of plants, induce parthenocarpy and inhibit senescence, etc. Gibberellins are widely used in fruits, vegetables, rice and other crops. Gibberellins can also be used in the beer production industry. In recent years, with the promotion and use of gibberellin, the market demand has been increasing. [0003] Gibberellin is mainly produced by microbial fermentation, and the producing bacterium is the rice bakanae pathogen Gibberella fujikuroi, and gibberellin is the isoprene secondary metabolit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/15C12N15/09C12N15/80C12P27/00A01P21/00
Inventor朱廷恒王渭霞裘娟萍
OwnerZHEJIANG UNIV OF TECH