Construction and expression of recombinant human B cell stimulating factor (rhBLyS) expression vector, and monoclonal antibody preparation and use

A monoclonal antibody and stimulatory factor technology, applied in the fields of application, antibody, recombinant DNA technology, etc., can solve problems such as difficulties in developing antibodies

Inactive Publication Date: 2003-03-12
张志方 +1
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

BLyS molecules mainly exist on the membrane of activated T lymphocytes, it is very difficult to obtain purified antigens directly from human blood cells to immunize animals and develop antibodies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and expression of recombinant human B cell stimulating factor (rhBLyS) expression vector, and monoclonal antibody preparation and use
  • Construction and expression of recombinant human B cell stimulating factor (rhBLyS) expression vector, and monoclonal antibody preparation and use
  • Construction and expression of recombinant human B cell stimulating factor (rhBLyS) expression vector, and monoclonal antibody preparation and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1, the acquisition of hBLyS cDNA

[0027] Peripheral blood lymphocytes from healthy people were isolated, activated by adding phytohamagglutinin (PHA) 1 μg / ml and phorbol 12-myristate 13-acetate (PMA) 10 ng / ml, and cultured at 37°C for 8 hours, then the cultured cells were collected. Total RNA was extracted according to the one-step method of guanidine isothiohydrogen, and quantified by ultraviolet spectrophotometer. According to the full-length hBLyS gene sequence, a pair of primers were designed and synthesized,

[0028] P15 `GTCGAATTCATGGATGACTCCACAG3`,

[0029] P25 `CACGTCGACTCACAGCAGTTTCAATG3`,

[0030] The 5' end primer contains an EcoR I restriction site and a start codon, and the 3' end primer contains a Sal I restriction site and a termination codon. Using the extracted total RNA as a template, the first strand of cDNA was synthesized by reverse transcription, and then amplified by conventional PCR. The amplification conditions were: denaturation ...

Embodiment 2

[0031]The PCR amplification product of hBLyS gene was double-digested by EcoR I and Sal I, and inserted into the EcoR I and Sal I double-digestion window of pGEX-4T-1 to obtain a recombinant plasmid containing the GST-hBLyS fusion protein gene. The construction process was as follows: Figure 2 shows. Transform Escherichia coli BL21 with the recombinant plasmid, then spread the Escherichia coli BL21 on the LB plate containing ampicillin, overnight at 37°C, and observe that pGEX-4T-1 / hBLyS plasmid transformed bacteria are evenly distributed on the plate on the next day, respectively. After the pGEX-4T-1 / hBLyS and pGEX-4T-1 plasmid transformed bacteria were amplified, the plasmid DNA was extracted for enzyme digestion and identification. After 1.0% agarose gel electrophoresis, it can be seen that EcoR I and Sal I double enzymes After cleavage, two fragments were obtained, namely pGEX-4T-1 of about 4.9kb and hBLyS gene fragment of about 858bp, which were consistent with the theore...

Embodiment 3

[0031]The PCR amplification product of hBLyS gene was double-digested by EcoR I and Sal I, and inserted into the EcoR I and Sal I double-digestion window of pGEX-4T-1 to obtain a recombinant plasmid containing the GST-hBLyS fusion protein gene. The construction process was as follows: Figure 2 shows. Transform Escherichia coli BL21 with the recombinant plasmid, then spread the Escherichia coli BL21 on the LB plate containing ampicillin, overnight at 37°C, and observe that pGEX-4T-1 / hBLyS plasmid transformed bacteria are evenly distributed on the plate on the next day, respectively. After the pGEX-4T-1 / hBLyS and pGEX-4T-1 plasmid transformed bacteria were amplified, the plasmid DNA was extracted for enzyme digestion and identification. After 1.0% agarose gel electrophoresis, it can be seen that EcoR I and Sal I double enzymes After cleavage, two fragments were obtained, namely pGEX-4T-1 of about 4.9kb and hBLyS gene fragment of about 858bp, which were consistent with the theore...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

A recombinant plasmid vector containing human B lymphocyte stimulating factor (hBlyS) gene, the construction and expression of said expression vector, the process for preparing its monoclonal antibody and the application of said monoclonal antibody in preparing the medicines to treat B lymphocyte cancer and self-immunopathy and the test reagent for the BlyS concentration in human plasma are disclosed.

Description

(1) Technical field [0001] The invention relates to an expression vector, in particular to an expression vector containing human B lymphocyte stimulating factor (hBlyS) gene. The invention also relates to the construction and expression of the expression vector, as well as the preparation and application of the monoclonal antibody. (2) Background technology [0002] BLyS (B lymphocyte stimulator) is a new member of tumor necrosis factor (Tumor necrosis factor, TNF) family, it contains 285 amino acids, is a type II transmembrane protein. BLyS is mainly synthesized by T lymphocytes and dendritic cells, and its receptors are only located on the membrane surface of B lymphocytes. [0003] BLyS was named THANK (TNF homologue that activates apoptosis, nuclear factor κB, and c-jun NH2-terminal kinase), TALL-1 (TNF andapoptosis ligand-related leukocyte-expressed ligand 1), zTNF4, TNFRSF19, BAFF (Bcell activating factor belonging to the TNF family) and so on. BLyS plays an importa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/395C07K19/00C12N1/21C12N15/12C12N15/54C12N15/63C12N15/70
Inventor 张志方
Owner 张志方
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap