Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Development of clone of domestic animal used as mammary gland boireactor by means of Cre-LoxP site-specific targeting somatic cell

A technique for livestock and mammary glands, applied in the field of biology

Inactive Publication Date: 2004-06-09
SHANGHAI GENON BIOENG
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, so far, there is still a lack of technology in the art to efficiently and rapidly prepare transgenic cloned animals with site-specific integration and mammary gland-specific expression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Development of clone of domestic animal used as mammary gland boireactor by means of Cre-LoxP site-specific targeting somatic cell
  • Development of clone of domestic animal used as mammary gland boireactor by means of Cre-LoxP site-specific targeting somatic cell
  • Development of clone of domestic animal used as mammary gland boireactor by means of Cre-LoxP site-specific targeting somatic cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1 Construction of targeted targeting vector

[0066] (A) Preparation of pBC-LoxP targeting vector

[0067] Component name

SEQ ID NO

Native goat β-casein 5' homology arm

1

LoxP gene

2

Neo resistance gene

3

Native goat β-casein 3' homology arm

4

TK resistance gene

5

[0068] 1. The source of each component

[0069] 1) Native goat β-casein homology arm

[0070] According to the sequence reported by GENBANK gi:15425979, the following primers BCZ5's were designed and synthesized: TTCACGCAAAGATGGGCAC (SEQ ID NO: 6) and BC-Pc: GTCTTGGATTGCTTAGAAAACCC (SEQ ID NO: 7). Using the extracted goat genomic DNA as a template, the sequence of the first half of the 5' homology arm of β-casein was amplified by PCR (94°C, 5min; 94°C, 1min; 60°C, 45s; 72°C, 3min, 30 cycles) . The PCR product was cloned into pGEM-Teasy vector (purchased from Promega Company) to obtain plasmid pnBC51.

...

Embodiment 2

[0115] Example 2 Cell transfection screening and identification of site-specific targeting vectors

[0116] 1. Saanen Dairy Goat Fetal Fibroblasts

[0117] Saanen dairy goat fetal fibroblasts were cultured according to conventional methods. That is, the fetus was collected from a 35-day-pregnant female goat through surgery, and after removing the head, limbs and internal organs, cut it into a puree, add trypsin (0.25% Trypsin / 1mM EDTA), digest at 37°C for 20 minutes, and then add 10% FCS The DMEM culture solution was used to stop the digestion, and centrifuged at 500g for 15min. Discard the supernatant, resuspend the cells in the culture medium, inoculate into a culture bottle, and place in an incubator at 37°C, 5% CO 2 Grow and freeze.

[0118] 2. Recovery and Expansion of Goat Fibroblasts (GEF)

[0119] The cryopreserved female goat fibroblasts (GEF) were revived, placed in 37°C containing 5% CO2 incubator with DMEM / F12 culture medium with 15% fetal bovine serum, and cul...

Embodiment 3

[0149] Example 3 Preparation of cloned animals for site-specific targeting of monoclonal cells

[0150] 1 Materials and methods

[0151] 1.1. Reagents are all embryo grade reagents, unless otherwise specified are Sigma products.

[0152] 1.2 Method

[0153] 1.2.1 Collection of donated oocytes Superovulation of dairy goats was performed routinely with FSH. 29-30 hours after injection of LRH, oocytes were recovered by surgery, and fertilized with FCS containing 5% calf serum (FCS, Gibco). -10 (Gibco) culture solution was used to flush oviducts. Oocytes are collected and hyaluronidase removes attached granulosa cells. The collected oocytes were placed in M16 solution and cultured in an incubator with 5% carbon dioxide at 37.5°C.

[0154] 1.2.2 Starvation treatment of nucleated cells The monoclonal cell line with site-specific integration will be obtained. After starvation with 0.5% FCS for 72 hours, a part of the cells will be frozen and stored in a -80°C refrigerator, and re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a method for preparing clonal livestock as mammary gland bioreactor by using Cre-LoxP to make site-speciofic target practice of body cell. Said method includes the following steps: (a). site-specific introducing the constituent containing LoxP sequence into fibroblast; (b). screening LoxP sequence site-specific integrated cell; (c). making target practive carrier containing exogenous gene and Cre expression plasmid / Cre protein cotransfect LoxP sequene site-specific integrated cell so as to screen and obtain the cell of site-specific integrated exogenous gene; and (d). reforming clonal animal. Said invention also provides correspondent constituent and clonal cell.

Description

technical field [0001] The invention relates to biological fields such as genetic engineering, embryo engineering and livestock breeding engineering. Specifically, the present invention relates to fetal fibroblasts of transgenic cloned livestock containing LoxP-marker gene site-directed integration and cloned livestock, as well as their preparation method and use. Background technique [0002] Transgenic animals (including livestock) have broad application prospects in the basic research of life sciences, biopharmaceuticals, and xenotransplantation research, especially in the biopharmaceutical industry, which uses transgenic animal bioreactors to produce biologically active medical proteins. Generate huge commercial profits in the biopharmaceutical industry. There are many methods for preparing transgenic animals, such as microinjection, liposome-mediated, sperm-mediated, etc. Among them, microinjection is a classic method, but the integration rate of transgenes in livestoc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01K67/00A01K67/027C12N5/10C12N15/09C12N15/12C12N15/85C12N15/873
Inventor 成国祥陈建泉吴国祥汤家铭赵建阳
Owner SHANGHAI GENON BIOENG
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More