Abalone species discriminating method
A kind of abalone technology, applied in the field of abalone species identification, can solve the problem that abalone larvae and processed products cannot be identified and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0021] Take 8-10 mg tissue samples of Panbao and Panbao wrinkle, extract total DNA with proteinase K-phenol-chloroform method or DNA extraction kit, and dissolve in distilled water. Take the total DNA extracted above, use the 5 pairs of specific primers described in Table 1, and carry out PCR amplification according to the following PCR amplification reaction conditions (10 reactions in total): Reaction system (10-20 μL): DNA template 10- 100ng; 1X PCR buffer; dNTPs 2mM; MgCl 2 1.5mM; forward and reverse specific primers 0.2mM each; Taq enzyme 0.5-1.0U (commercially available). PCR cycle conditions: 94°C for 2min; 94°C for 30sec, 52°C for 1min, 72°C for 1min, cycled 30 times; 72°C for 5-10min. Take 4 μL of the PCR reaction product, electrophoresis on 1.1% agarose gel for 12 min, voltage 5-10 v / cm, add 0.5-2 μg / ml ethidium bromide to the gel. Observing the gel after electrophoresis under ultraviolet light, two reactions with P. abalone and P. abalone-specific primers showed s...
Embodiment 2
[0023] Take 15 mg of variegated abalone or abalone tissue sample, extract the total DNA according to the method in Example 1, and use the same conditions and methods as in Example 1 to perform PCR reaction and agarose electrophoresis to detect the reaction product. Observing the gel after electrophoresis under ultraviolet light, it was found that two reactions with specific primers for abalone (variegated abalone) showed significant amplified bands, while the reactions with other specific primers for abalone had no amplification Bands. The sequences of the specific primers used for Abalone abalone (Verticolor abalone) are F: 5'TCTGAACATATCTTTATGTC3' and R: 5'AGTACGTCCGTTGATGAATG3'.
Embodiment 3
[0025] Take 20 mg of tissue samples of abalone, extract total DNA with proteinase K-phenol-chloroform method or DNA extraction kit, and dissolve with TE solution. Take the total DNA extracted above, and carry out PCR amplification according to the following PCR amplification reaction conditions: Reaction system (10-20μL): DNA template 10-100ng; 1X PCR buffer; dNTPs 2mM; MgCl 2 1.5mM; forward and reverse specific primers 0.2mM each; Taq enzyme 0.5-1.0U (commercially available). PCR cycle conditions: 94°C for 2min; 94°C for 30sec, 52°C for 1min, 72°C for 1min, cycled 30 times; 72°C for 5-10min. Take 4.5 μL of the PCR reaction product, electrophoresis with 1.3% agarose gel for 20 min, add 0.5-2 μg / ml ethidium bromide to the gel. Observation of the gel after electrophoresis under ultraviolet light revealed significant amplified bands. The sequences of the specific primers used were F: 5'GGTTTATATTTCCTAGTTG3' and R: 5'CGGATCATTAGCTAGCAAG3'. At the same time, PCR amplification an...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com