Check patentability & draft patents in minutes with Patsnap Eureka AI!

Abalone species discriminating method

A kind of abalone technology, applied in the field of abalone species identification, can solve the problem that abalone larvae and processed products cannot be identified and the like

Inactive Publication Date: 2006-02-22
JIMEI UNIV
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to solve the problem that the existing method of identifying and identifying the raw material fish species of fish processed products based on the difference of enzyme digestion results cannot be used for the identification of abalone larvae and processed products, and to provide a simple method for identifying abalone species

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Take 8-10 mg tissue samples of Panbao and Panbao wrinkle, extract total DNA with proteinase K-phenol-chloroform method or DNA extraction kit, and dissolve in distilled water. Take the total DNA extracted above, use the 5 pairs of specific primers described in Table 1, and carry out PCR amplification according to the following PCR amplification reaction conditions (10 reactions in total): Reaction system (10-20 μL): DNA template 10- 100ng; 1X PCR buffer; dNTPs 2mM; MgCl 2 1.5mM; forward and reverse specific primers 0.2mM each; Taq enzyme 0.5-1.0U (commercially available). PCR cycle conditions: 94°C for 2min; 94°C for 30sec, 52°C for 1min, 72°C for 1min, cycled 30 times; 72°C for 5-10min. Take 4 μL of the PCR reaction product, electrophoresis on 1.1% agarose gel for 12 min, voltage 5-10 v / cm, add 0.5-2 μg / ml ethidium bromide to the gel. Observing the gel after electrophoresis under ultraviolet light, two reactions with P. abalone and P. abalone-specific primers showed s...

Embodiment 2

[0023] Take 15 mg of variegated abalone or abalone tissue sample, extract the total DNA according to the method in Example 1, and use the same conditions and methods as in Example 1 to perform PCR reaction and agarose electrophoresis to detect the reaction product. Observing the gel after electrophoresis under ultraviolet light, it was found that two reactions with specific primers for abalone (variegated abalone) showed significant amplified bands, while the reactions with other specific primers for abalone had no amplification Bands. The sequences of the specific primers used for Abalone abalone (Verticolor abalone) are F: 5'TCTGAACATATCTTTATGTC3' and R: 5'AGTACGTCCGTTGATGAATG3'.

Embodiment 3

[0025] Take 20 mg of tissue samples of abalone, extract total DNA with proteinase K-phenol-chloroform method or DNA extraction kit, and dissolve with TE solution. Take the total DNA extracted above, and carry out PCR amplification according to the following PCR amplification reaction conditions: Reaction system (10-20μL): DNA template 10-100ng; 1X PCR buffer; dNTPs 2mM; MgCl 2 1.5mM; forward and reverse specific primers 0.2mM each; Taq enzyme 0.5-1.0U (commercially available). PCR cycle conditions: 94°C for 2min; 94°C for 30sec, 52°C for 1min, 72°C for 1min, cycled 30 times; 72°C for 5-10min. Take 4.5 μL of the PCR reaction product, electrophoresis with 1.3% agarose gel for 20 min, add 0.5-2 μg / ml ethidium bromide to the gel. Observation of the gel after electrophoresis under ultraviolet light revealed significant amplified bands. The sequences of the specific primers used were F: 5'GGTTTATATTTCCTAGTTG3' and R: 5'CGGATCATTAGCTAGCAAG3'. At the same time, PCR amplification an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention relates to one identification method of abalone materials, which comprises the following steps: taking abalone sample for 10í½25mg and extracting agent case total DNA by use of proleaseK-phenol-chloroform or for TE solving; Taking the above total DNA as the normal condition and expanding the PCR by use of isomerism subjects; taking PCR reaction product through agar gel electrophoresis with ethylene bromide; observing the gel under violet light to find out each isomerism with its relative bar.

Description

technical field [0001] The invention relates to a method for identifying abalone biological materials, in particular to a method for identifying abalone species. Background technique [0002] Abalone, commonly known as abalone, is a kind of marine economic animal with high economic value. Its meat is edible and delicious. It is a famous traditional sea treasure in my country. Its shell can be used as medicine. The effect of clearing the liver and improving eyesight. In recent years, with the reduction of wild abalone resources and the increase of market demand, the artificial breeding industry of nine-hole abalone (variegated color abalone), pan abalone and wrinkled pan abalone has been greatly developed, and sheep abalone and ear abalone have also been tested Among them, it is expected that it will gradually develop in the future. [0003] Different types of abalone have different quality (meat quality, flavor, nutritional value) and different prices. Fresh or unprocessed...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N27/447G01N1/28C12Q1/68B01D57/02
Inventor 王志勇曾雅娟柯才焕
Owner JIMEI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More