Production of L phenylalanine gene engineering bacteria and construction method and its application

A technology of genetic engineering bacteria and phenylalanine, applied in the field of preparation of L-phenylalanine, can solve the problem of high cost

Inactive Publication Date: 2006-04-12
NANJING UNIV OF TECH
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] (3) Enzymatic resolution: on the basis of chemical synthesis of racemic intermediates (such as N-acetyl DL-phenylalanine), selective enzymatic degradation is used to prepare L-phenylalanine. This method is costly and has no industry cultured report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Production of L phenylalanine gene engineering bacteria and construction method and its application
  • Production of L phenylalanine gene engineering bacteria and construction method and its application
  • Production of L phenylalanine gene engineering bacteria and construction method and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Construction of genetically engineered bacteria E.coli BL21-pUC / aspC

[0045] The aspartate aminotransferase aspC gene was adjusted from Escherichia coli K12 (standard strain). Retrieved by NCBI, according to the reported Escherichia coli K12 (standard strain) aspC sequence, the primers were designed by VectorNTI8.0 software as follows:

[0046] Forward primer 1: 5'ATGTTTGAGAACATTACCGC 3'

[0047] Reverse primer 2: 5'GTTTGTCATCAGTCTCAGCC 3'.

[0048] The aspartate aminotransferase gene aspC of Escherichia coli K12 was fished by PCR, and connected with the following constitutive promoter (referred to as P-121), (the changed base part of the promoter is underlined),

[0049] TGTTGTGTGGAATTGTGAGTGGCTAACAATTTCACACA

[0050] ACAACACACCTTAACACTC A CC G ATTGTTAAAGTGTGT

[0051]And P121-aspC was inserted into the pMD-18T vector of TaKaRa Company, and the captured aspC gene was sequenced and identified. Using the HindIII and EcoR I sites of the T vector, a new f...

Embodiment 2

[0052] Example 2 Genetically engineered bacteria E.coli BL21-pET / aspC

[0053] The aspartate aminotransferase gene aspC was linked with the following constitutive promoter (denoted as P123) (the modified base of the promoter is underlined), and P123-aspC was obtained.

[0054] TGTTGTGTGGAATTGTGAGCGGATTGCAATTTCACACA

[0055] ACAACACACCTTAACACTCGCCTA AC GTTAAAGTGTGTP

[0056] P123-aspC was inserted into the pMD-18T vector of TaKaRa Company, and the captured aspC gene was sequenced and identified. A new fragment P123-aspC with a restriction site was obtained by double enzyme digestion with the HindIII and EcoR I sites of the T vector. Inserted into the vector pET22b after the same digestion. Obtain the recombinant plasmid pET / aspC. Prepare E.coli BL21 competent cells, introduce the recombinant plasmid pET / aspC into E.coli BL21, and select the recombinant E.coli BL21-pET / aspC.

Embodiment 3

[0057] Example 3 Construction of Genetically Engineered Bacteria E.coli ATCC11303-pUC / aspC

[0058] Prepare competent cells of natural bacteria E.coli ATCC11303 containing highly active aspartase (aspA), introduce the recombinant plasmid pUC / aspC constructed in Example 1 into E.coli ATCC11303, and select the recombinant E.coliATCC11303- pUC / aspC.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A genetically engineered bacterium for preparing L-Phe is prepared from transaminase gene and constitutive promoter through linking, and inserting them into carrier to configure constitutive expression plasmid. The L-Phe can be prepared through converting the phenylphruvic acid in proper host bacteria by relative said genetically engineered bacterium. It has high mole conversion rate.

Description

technical field [0001] The invention belongs to the technical field of amino acid preparation, and in particular relates to a method for preparing L-phenylalanine using constitutively activated genetic engineering bacteria. Background technique [0002] L-phenylalanine (English name L-phenylalanine) is a physiologically active aromatic amino acid. It is one of the essential amino acids that cannot be synthesized by humans and animals. It is widely used in medicine. For example, L-phenylalanine is a certain amino acid Intermediates of anticancer drugs, such as: amphetamine, sarcoid formic acid, etc. (Wang Duoren. Chemical Intermediates 2004, 1(2): 12~20). Amino acids can also be used as carriers to load anticancer drug molecules or groups into the tumor area to achieve the purpose of not only inhibiting tumor growth, but also reducing the toxicity of tumor drugs (Janet T Powell et al., Eur.J Biochem.1978, (87 ): 391~400). L-phenylalanine is also an important component of co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/70C12P13/22
Inventor何冰芳欧阳平凯李霜宫长斌姜岷周华韦萍
OwnerNANJING UNIV OF TECH