Production of L phenylalanine gene engineering bacteria and construction method and its application
A technology of genetic engineering bacteria and phenylalanine, applied in the field of preparation of L-phenylalanine, can solve the problem of high cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1 Construction of genetically engineered bacteria E.coli BL21-pUC / aspC
[0045] The aspartate aminotransferase aspC gene was adjusted from Escherichia coli K12 (standard strain). Retrieved by NCBI, according to the reported Escherichia coli K12 (standard strain) aspC sequence, the primers were designed by VectorNTI8.0 software as follows:
[0046] Forward primer 1: 5'ATGTTTGAGAACATTACCGC 3'
[0047] Reverse primer 2: 5'GTTTGTCATCAGTCTCAGCC 3'.
[0048] The aspartate aminotransferase gene aspC of Escherichia coli K12 was fished by PCR, and connected with the following constitutive promoter (referred to as P-121), (the changed base part of the promoter is underlined),
[0049] TGTTGTGTGGAATTGTGAGTGGCTAACAATTTCACACA
[0050] ACAACACACCTTAACACTC A CC G ATTGTTAAAGTGTGT
[0051]And P121-aspC was inserted into the pMD-18T vector of TaKaRa Company, and the captured aspC gene was sequenced and identified. Using the HindIII and EcoR I sites of the T vector, a new f...
Embodiment 2
[0052] Example 2 Genetically engineered bacteria E.coli BL21-pET / aspC
[0053] The aspartate aminotransferase gene aspC was linked with the following constitutive promoter (denoted as P123) (the modified base of the promoter is underlined), and P123-aspC was obtained.
[0054] TGTTGTGTGGAATTGTGAGCGGATTGCAATTTCACACA
[0055] ACAACACACCTTAACACTCGCCTA AC GTTAAAGTGTGTP
[0056] P123-aspC was inserted into the pMD-18T vector of TaKaRa Company, and the captured aspC gene was sequenced and identified. A new fragment P123-aspC with a restriction site was obtained by double enzyme digestion with the HindIII and EcoR I sites of the T vector. Inserted into the vector pET22b after the same digestion. Obtain the recombinant plasmid pET / aspC. Prepare E.coli BL21 competent cells, introduce the recombinant plasmid pET / aspC into E.coli BL21, and select the recombinant E.coli BL21-pET / aspC.
Embodiment 3
[0057] Example 3 Construction of Genetically Engineered Bacteria E.coli ATCC11303-pUC / aspC
[0058] Prepare competent cells of natural bacteria E.coli ATCC11303 containing highly active aspartase (aspA), introduce the recombinant plasmid pUC / aspC constructed in Example 1 into E.coli ATCC11303, and select the recombinant E.coliATCC11303- pUC / aspC.
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap