Recombined collagen and synthesizing and expressing purifying process thereof

A technology of recombinant collagen and synthetic method, applied in the direction of recombinant DNA technology, animal/human protein, connective tissue peptide, etc., can solve the problem of inability to form hydroxyproline residues and inability to synthesize proline-4-hydroxylase and other issues to achieve the effect of low immune rejection

Inactive Publication Date: 2006-06-28
ZHEJIANG SCI-TECH UNIV
View PDF1 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in most Escherichia coli and yeast, they cannot synthesize proline-4-hydroxylase at all, so they cannot form hydroxyproline residues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombined collagen and synthesizing and expressing purifying process thereof
  • Recombined collagen and synthesizing and expressing purifying process thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Embodiment 1, the construction of recombinant collagen:

[0051] The amino acid sequence of a designed recombinant collagen is as follows:

[0052] [Gly-Glu-Arg-Gly-Asp-Leu-Gly-Pro-Gin-Gly-Ile-Ala-Gly-Gln-Arg-Gly-Val-Val-Gly-Glu-Arg-Gly-Glu-Arg-Gly -Glu-Arg-Gly-Ala-Ser]8-Gly-Pro-Pro-Gly-Pro-Cys-Cys-Gly-Gly-Gly

[0053] (1) Designed and synthesized four oligonucleotides: Coll-1, Coll-2, Fusion-1 and Fusion-2, and then used the annealing method to obtain two double-helical DNAs respectively, and their nucleotide sequences were respectively for:

[0054] Coll-1:

[0055] 5' CTAGTGGCGAACGTGGTGATCTGGGCCCGCAGGGTATCGCGGGCCAGCGTGGTGTGGTTGGCGAGCGTGGTGAACGCGGCGAGCGTGGTG 3'

[0056] Coll-2:

[0057] 5' CTAGCACCACGCTCGCCGCGTTCACCACGCTCCCGAACCACACCACGCTGGCCCGCGATACCCTGCGGGCCCAGATCACCACGTTCGCCA 3'

[0058] Fusion-1:

[0059] 5'CTAGTGGCCCGCCAGGTCCGTGCTGTGGCGGTGGCG 3'

[0060] Fusion-2:

[0061] 5'CTAGCGCCACCGCCACAGCACGGACCTGGCGGGCCA 3'

[0062] Coll-1 and Coll-2 obtained by ...

Embodiment 2

[0078] Embodiment 2, the expression of recombinant collagen protein:

[0079] (1) Transform the competent cell BL21(DE3)pLysS (purchased from Novagen) bacteria with the pET30a(+)-Coll(8)-Fusion plasmid verified by sequencing, pick a single colony and inoculate it in LB liquid medium, and culture it with shaking at 37°C overnight, and then inoculated in TB liquid medium containing 10-50 μg / ml kanamycin and 25-170 μg / ml chloramphenicol at a ratio of 1:100, when OD 600 When reaching about 0.5-1.0, add inducer IPTG to induce protein expression, and the concentration of IPTG is 0.1-2mM. After continuing to cultivate for 2-5 hours, the bacterial cells were collected by centrifugation (5000×g, 4° C. for 10 minutes).

[0080] The special feature of the present invention is that the time and temperature for inducing expression can be adjusted according to the actual situation, such as the solubility, stability and expression level of the target protein, which can be adjusted to 30°C f...

Embodiment 3

[0081] Embodiment 3, the purification of recombinant collagen protein:

[0082] The bacteria collected above were resuspended with ice-cold cell lysis buffer (Cell Lysis Buffer) 3-7 times the wet weight of the cells, placed in an ice bath, and the cells were ultrasonically disrupted to release the protein Coll(8)-Fusion. After the cells are broken, the viscosity of the liquid increases. If the viscosity of the mixed solution is too high, the cell lysate can be diluted appropriately, or MgCl with a final concentration of 5mM can be added. 2 10 μg / ml of protease-free DNase to reduce viscosity. Centrifuge at 20,000×g at 4°C for 30 minutes, and the supernatant is the clarified crude cell extract. The crude extract was subjected to metal chelation chromatography, dialyzed in distilled water, and then freeze-dried to collect the protein. Protein expression and purification results were confirmed by SDS-PAGE gel electrophoresis and Western blotting.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rebuilt collagen and the compounding and expression purifying method. The main body of the collagen amino acid sequence is triad Gly-Xaa-Yaa, of which Xaa and Yaa at least have an electrified amino acid residue. The N end and C end contains the sequence of cysteine residue; the Arg-Gly-Asp residue combination is contained in the entire amino acid sequence. Using the compounded oligonucleotide to take annealing treatment to form double helical target DAN monomer that takes repeatedly polymerizing to form macromolecule DNA which would transfer into coliform bacteria, thus, the rebuilt collagen would be gained. The invention has good application value and could be used in biology medicine material, cosmetic and food fields.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a recombinant collagen similar to natural collagen and a synthesis method thereof. Background technique [0002] Collagen is abundant in mammals and usually exists in the form of collagen fibers. It is very important for the formation of animal and human skin, blood vessels, tendons and cartilage, and provides certain structural and mechanical properties for these connective tissues. Collagen has been widely used in the fields of biomedical materials, tissue engineering, cosmetics and food due to its inherent biocompatibility, biodegradability and absorbability, and many functions such as promoting cell growth. In terms of molecular structure, collagen is composed of parallel linear chains, and each linear chain is composed of three twisted left-handed polypeptide chains tightly combined through interchain hydrogen bonds to form a very strong right-handed triple helix structure. The...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/78C12N1/14C12N15/63C12N15/64C12P21/02
Inventor姚菊明
OwnerZHEJIANG SCI-TECH UNIV