Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Compositions and methods for early pregnancy diagnosis

a technology of early pregnancy and composition, applied in the field of veterinary medicine, reproductive biology and diagnostics, can solve the problems of inability to accurately detect early pregnancy, low practical value, and high false positive rate of milk or serum progesterone measurement around day 18-22, and achieve the effect of sensitive and accurate measuremen

Inactive Publication Date: 2005-05-12
ROBERTS ROBERT +2
View PDF5 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0009] Therefore, it is an objective of the present invention to provide a sensitive and accurate test for early pregnancy. Using a selected boPAG as the biochemical marker, the present invention provides an early pregnancy test in which the PAG antigen a) is produced abundantly in early, and preferably not in late, pregnancy, b) is a product of the binucleate cell, and absent or not present in significant amounts postpartum, and c) minimally cross-reacts with late PAG products that might persist in maternal serum during the post-partum interval. The early immunoassay will be particularly useful in the dairy industry where animals are usually confined for at least part of the day and where intensive management is practiced. A modified test also is likely to have value in captive breeding programs for other animals, e.g., for the ruminants okapi or giraffe and possibly for other non-ruminant species.

Problems solved by technology

Even though all the procedures are potentially useful, all have fallen short of expectations in terms of their practical, on-farm use.
For example, measurements of milk or serum progesterone around day 18-22 yield unacceptably high rates of false positives (Oltenacu et al., 1990; Markusfeld et al., 1990).
Ultrasonography has an advantage over rectal palpation in accuracy, particularly before day 45 (Beal et al., 1992; Cameron and Malmo, 1993), but the instrument is expensive, its use requires considerable training, and there is a finite risk to the animal.
First, it can detect pregnancy relatively early.
There remain, however, two major disadvantages to this procedure.
First, positive diagnosis in the fourth week of pregnancy remains somewhat uncertain because antigen concentrations in blood are low and somewhat variable.
Such delays are extremely costly and constitute a major economic loss to the industry.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compositions and methods for early pregnancy diagnosis
  • Compositions and methods for early pregnancy diagnosis
  • Compositions and methods for early pregnancy diagnosis

Examples

Experimental program
Comparison scheme
Effect test

example 1

A. Example 1

Cloning of boPAGs from Placental Tissues Early in Pregnancy

[0184] Materials and Methods: Bovine PAG transcripts were cloned from day 19 and 25 placentae. RNA from six (Simmental×Hereford) placentas at day 25 of pregnancy was used to construct a cDNA library in λZAPII (Clontech, Palo Alto, Calif.). The library was screened with a mixed probe of 32P-labeled bovine, ovine and porcine PAG1 and PAG2, and equine PAG cDNA (Xie et al., 1991, Xie et al., 1994; Xie et al., 1995; Szafranska et al., 1995). The positive clones were isolated and analyzed for the size of inserts by PCR™ and restriction endonuclease digestion. Sixteen clones of the expected length were partially sequenced. The second screening identified boPAG transcripts that reacted with an anti-boPAG1 antiserum (Zoli et al., 1991; Xie et al., 1991). Duplicate filter screening was employed to increase the frequency of isolation of full length clones. The first filter was allowed to react with antiserum to identify im...

example 2

B. Example 2

Structural Relationships Among boPAGs

[0190] Materials and Methods: The amino acid sequences of various PAGs and pepsin were assembled into multiple sequence alignments with the Pile Up Program of the Wisconsin GCG Package, Version 9.0 (Madison, Wis.). A distance matrix was then created (Program Distances) and a phylogenetic tree constructed by a neighbor-joining procedure (Nei, 1987).

[0191] Results: The data in FIG. 5 is a phylogenetic tree relating all of the bovine PAGs (FIG. 1) and ovine PAGs (FIG. 2) that have so far been cloned as cDNA. The methods used for cloning these PAG cDNAs is described by Xie et al., 1997b. Also included in FIG. 5 are rabbit pepsinogen F and porcine pepsinogen A, the aspartic proteinases structurally most similar to PAGs. Note that the bovine and ovine PAGs fall largely into two structurally related groups. One contains boPAG2, -10, -11, and -12, along with ovPAG2 and ovPAG5. The other is comprised of boPAG1, 3, 4, 5, 6, 7, and 9. As point...

example 3

C. Example 3

Certain Early PAGs are Expressed in Trophoblast Binucleate Cells and in the Syncytium Formed Between Trophectoderm and Uterine Epithelium

[0192] Materials and Methods: Riboprobes (cRNA) were prepared by using the Riboprobe Preparation System (Promega, WI, USA). Briefly, two regions of the boPAG cDNA, representing poorly conserved sequences, were used as the probe in situ hybridization (and ribonuclease protection assay: see next section). The first fragment (536 bp) of boPAG2, 4, 8, 9 or 11 cDNA, that was in the region of exons 6, 7, 8 and 9, was amplified by using PCR™ with a pair of primers (Forward 5′CCTCTTTTGCCTTCTACTTGA3′ (SEQ ID NO: 18, and Reverse 5′GCGCTCGAGTTACACTGCCCGTGCCAGGC3′ (SEQ ID NO: 19). However, another region (407 bp) was chosen for boPAG1, 5, 6 and 7 cDNA, corresponding to exons 3, 4 and 5. Again it was amplified by a PCR™ procedure with two well conserved primers (Forward B: 5′TGGGTAACATCACCATTGGAA3′ (SEQ ID NO:20, Reverse B: 5′TTTCTGAGCCTGTTTTTGCC5′...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Timeaaaaaaaaaa
Login to View More

Abstract

Pregnancy-associated glycoproteins (PAGs) are structurally related to the pepsins, thought to be restricted to the hoofed (ungulate) mammals and characterized by being expressed specifically in the outer epithelial cell layer (chorion / trophectoderm) of the placenta. By cloning expressed genes from ovine and bovine placental cDNA libraries, the inventors estimate that cattle, sheep, and most probably all ruminant Artiodactyla, possess possibly 100 or more PAG genes, many of which are placentally expressed. The PAGs are highly diverse in sequence, with regions of hypervariability confined largely to surface-exposed loops. Selected PAG that are products of the i0nvasive binucleate cells, expressed highly in early pregnancy at the time of trophoblast invasion and expressed weakly, if at all, in late gestation are useful in the early diagnosis of pregnancy. In a preferred embodiment, the invention relates to immunoassays for detecting these PAGs.

Description

BACKGROUND OF THE INVENTION [0001] This application claims priority to U.S. Provisional Application Ser. No. 60 / 078,783 filed Mar. 20, 1998 and U.S. Provisional Application Ser. No. 60 / 106,188 filed Oct. 28, 1998. The entire text of each of the above-referenced disclosures is specifically incorporated by reference herein without disclaimer. The government may own rights in the present invention pursuant to grant R37 HD29483 and USDA grant 9601842. [0002] I. Field of the Invention [0003] The present invention relates generally to the fields of veterinary medicine, reproductive biology and diagnostics. More specifically, the present invention relates to the use of analytical methods to detect early stage pregnancy. [0004] II. Related Art [0005] Pregnancy diagnosis is an important component in sound reproductive management, particularly in the dairy industry (Oltenacu et al., 1990) where a high proportion of artificial inseminations fail (Streenan and Diskin, 1986). A reliable yet simp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/47G01N33/53G01N33/68
CPCC07K14/47G01N33/689Y10S435/973G01N2800/368G01N2333/471
Inventor ROBERTS, ROBERTGREEN, JONATHANXIE, SANCAI
Owner ROBERTS ROBERT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products