Gene specifically expressed in postmitotic dopaminergic neuron precursor cells

a dopaminergic neuron and gene technology, applied in the field of new 65b13 gene expressed in postmitotic dopaminergic neurons, to achieve the effect of high therapeutic efficacy, convenient preparation, and efficient separation

Inactive Publication Date: 2007-05-31
EISIA R&D MANAGEMENT CO LTD
View PDF6 Cites 57 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The present invention relates to a new gene, called 65B13, which is specifically expressed in dopaminergic neuron precursor cells. The invention aims to isolate this gene to improve the safety and effectiveness of neural circuit formation for transplant therapy in Parkinson's disease. By using early-stage dopaminergic neuron precursor cells, the risk of tumorigenesis is reduced, and the survival rate and network formation ability of the cells are improved. The invention also provides a method for isolating pure early-stage dopaminergic neuron precursor cells, which are safer and more efficient for transplant therapy. The isolated cells can also be used for research and development of new therapies for Parkinson's disease.

Problems solved by technology

One of the major problems in Parkinson's disease (PD) transplant therapy at the moment is that in vitro differentiated dopaminergic neuron precursor cells and midbrain ventral zone of aborted fetuses are both mixtures of myriad types of cells.
Further, in the cases where the best therapeutic effects cannot be achieved by these early precursor cells obtained immediately after cell cycle exit, and where the use of matured cells is required, early precursor cells obtained by this method can simply be cultured in vitro to mature into a suitable stage of differentiation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene specifically expressed in postmitotic dopaminergic neuron precursor cells
  • Gene specifically expressed in postmitotic dopaminergic neuron precursor cells
  • Gene specifically expressed in postmitotic dopaminergic neuron precursor cells

Examples

Experimental program
Comparison scheme
Effect test

example 1

Isolation and Sequence Analysis of a Gene Specific for Dopaminergic Neuron Precursor Cells

[0123] To isolate a gene specific to dopaminergic neuron precursor cells, genes with differences in expression were amplified by the subtraction (N-RDA) method using RNA from ventral and dorsal midbrain of E12.5 mice, and sequences of the resulting genes were analyzed.

1. N-RDA Method

1-1. Adapter Preparation

[0124] The following oligonucleotides were annealed to each other, and prepared at 100 μM. (ad2: ad2S+ad2A, ad3: ad3S+ad3A, ad4: ad4S+ad4A, ad5: ad5S+ad5A, ad13: ad13S+ad13A)

ad2S:cagctccacaacctacatcattccgt(SEQ ID NO:11)ad2A:acggaatgatgt(SEQ ID NO:12)ad3S:gtccatcttctctctgagactctggt(SEQ ID NO:13)ad3A:accagagtctca(SEQ ID NO:14)ad4S:ctgatgggtgtcttctgtgagtgtgt(SEQ ID NO:15)ad4A:acacacteacag(SEQ ID NO:16)ad5S:ccagcatcgagaatcagtgtgacagt(SEQ ID NO:17)ad5A:actgtcacactg(SEQ ID NO:18)ad13S:gtcgatgaacttcgactgtcgatcgt(SEQ ID NO:19)ad13A:acgatcgacagt.(SEQ ID NO:20)

1-2. cDNA Synthesis

[0125] Total ...

example 2

Expression Analysis of the 65B13 Genes

[0164] Next, an expression analysis of these genes by in situ hybridization was carried out according to the following protocol.

[0165] First, E12.5 mouse embryos were embedded in O.C.T., and fresh frozen sections of 16 μm thickness were prepared. After drying on a slide glass, the sections were fixed in 4% PFA at room temperature for 30 minutes. After washing with PBS, hybridization was carried out at 65° C. for 40 hours (1 μg / ml DIG-labeled RNA probe, 50% formamide, 5×SSC, 1% SDS, 50 μg / ml yeast RNA, 50 μg / ml Heparin). Subsequently, the sections were washed at 65° C. (50% formamide, 5×SSC, 1% SDS) and then treated with RNase (5 μg / ml RNase) at room temperature for 5 minutes. After washing with 0.2×SSC at 65° C. and washing with 1×TBST at room temperature, blocking was carried out (Blocking reagent: Roche). The sections were then reacted with alkaline phosphatase-labeled anti-DIG antibody (DAKO), washed (1×TBST, 2 mM Levamisole), and color dev...

example 3

Expression Analysis of the 65B13 Proteins

[0168] Next, a portion of the 65B13 gene sequence that encodes the extracellular region was used to generate an anti-65B13 antibody to be used for expression analysis by immunohistochemical staining.

[0169] First, a partial sequence of the 65B13 gene that encodes the extracellular region was introduced into 293E cells, and the extracellular region of the 65B13 protein was expressed and recovered. After immunizing hamsters with the recovered protein, lymphocytes were extracted and fused with myeloma cells. The fused cells were then transplanted into the abdominal cavities of mice, ascites was obtained, and an anti-65B13 monoclonal antibody was purified. Next, E12.5 mouse embryos were fixed in 4% PFA / PBS(−) at 4° C. for 2 hours, and then stood overnight at 4° C. in 20% sucrose / PBS(−), followed by O.C.T. embedding. Sections of 12 um thickness were produced. After affixing to slide glasses, the sections were dried for 30 minutes at room temperat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
surfaceaaaaaaaaaa
heterogeneousaaaaaaaaaa
fluorescenceaaaaaaaaaa
Login to View More

Abstract

A novel gene 65B13 expressed specifically and transiently in dopaminergic neuron precursor cells immediately after cell cycle exit was obtained by the present invention. The cellular expression of 65B13 can be used as an index to select cells that are suitable in terms of their safety, survival rate, and network formation ability, for transplant therapy of neurodegenerative diseases such as Parkinson's disease.

Description

CROSS-REFERENCES TO RELATED APPLICATIONS [0001] This application is a continuation of U.S. patent application Ser. No. 10 / 532,264, 371 (c) date of Dec. 28, 2005, which is a U.S. National Phase of PCT / JP03 / 13420, filed Oct. 21, 2003, which claims priority to Japanese Application No. 2002-307573, filed Oct. 22, 2002. All of the aforementioned applications are hereby incorporated by reference in their entireties and for all purposes.STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT [0002] NOT APPLICABLE REFERENCE TO A “SEQUENCE LISTING,” A TABLE, OR A COMPUTER PROGRAM LISTING APPENDIX SUBMITTED ON A COMPACT DISK [0003] NOT APPLICABLE BACKGROUND OF THE INVENTION [0004] 1. Technical Field [0005] The present invention relates to the novel 65B13 gene expressed in postmitotic dopaminergic neurons. Dopaminergic neuron precursor cells used in transplant therapy for neurodegenerative diseases such as Parkinson's disease (PD) can be efficiently isolated...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C07K14/705C07K16/28C07H21/04C12P21/06C07K14/47C07K16/18C12N1/15C12N1/19C12N1/21C12N5/07C12N5/0797C12N5/10C12N15/09C12N15/12C12Q1/02C12Q1/04G01N33/68
CPCC07K14/47G01N33/6896
InventorNAKAGAWA, YASUKOONO, YUICHISAKAMOTO, YOSHIMASAMIZUHARA, ERINAKATANI, TOMOYATAKAI, YOSHIMI
OwnerEISIA R&D MANAGEMENT CO LTD