Use of non-agrobacterium bacterial species for plant transformation

Abstract

The invention relates to methods for Rhizobia-mediated genetic transformation of plant cells, including soybean, canola, corn, and cotton cells. These include both VirD2-dependent and VirD2-independent methods. Bacterial species utilized include strains of Rhizobium sp., Sinorhizobium sp., and Mesorhizobium sp. Vectors for use in such transformation are also disclosed.

Description

[0001] This application claims the priority of U.S. Provisional Patent Application 60 / 800,872, filed May 16, 2006, the disclosure of which is incorporated herein by reference in its entirety.BACKGROUND OF THE INVENTION

[0002] 1. Field of the Invention

[0003] The present invention relates to the field of plant biotechnology. In particular, the invention relates to methods for producing transgenic plants and plant cells by using non-Agrobacterium bacterial species.

[0004] 2. Description of Related Art

[0005] Agrobacterium spp., members of the Rhizobiales, are common soil bacteria, along with Rhizobium spp., Mesorhizobium spp., Sinorhizobium spp., and related species and genera. A number of wild-type and disarmed (non-pathogenic) strains of Agrobacterium tumefaciens and Agrobacterium rhizogenes harboring Ti or Ri plasmids can be used for gene transfer into plants. Phytohormone synthesis genes located in the T-DNA of wild type Agrobacteria harboring a Ti or Ri plasmid are expressed in pl...

Examples

example 1

Rhizobium and Agrobacterium Strains

[0095]Agrobacterium tumefaciens AGL0 was obtained from ATCC (ATCC Number: BAA-100™, Lazo et al., 1991). Rhizobium leguminosarum strain Madison and Sinorhizobium meliloti SD630 were isolated from weed clover in a home garden in Madison, Wis., USA, and confirmed by sequencing the PCR product of a 16S rRNA amplified with the following primers: 5′ GAGAGTTTGATCCTGGCTCAG 3′ (Xd578; SEQ ID NO:1) and 5′ AAGGAGGTGATCCAGCCGCAG 3′ (Xd579; SEQ ID NO:2). Other Rhizobium strains were obtained from USDA Rhizobium collection center (Table 1). Rhizobium strains were grown in TY or MAG medium and Agrobacterium in LB medium. Strains are shown below and 16s rRNA sequences amplified in strains isolated are provided as SEQ ID NOs:24-30.

TABLE 1Agrobacterium and Rhizobium strainsStrain NameTi plasmidSourceA. tumefaciens AGL0pTiBo542ATCC; Lazo et al., 1991A. tumefaciens LBA4404pAL4404Hoekema et al., 1983A. tumefaciens AGL0CpTiBo542C (kanR)This studyA. tumefaciens AGL0Gp...

example 2

Transformation of Agrobacterium

[0096] The Agrobacterium competent cells were prepared by washing a log phase culture in LB medium with chilled deionized water and 10% glycerol, and stored at −80° C. Fifty microliters of thawed competent cells were mixed with 1 or 2 μl DNA on ice and electroporated in 1 mm gap curvet with 200 ohm resistance, 25 μF capacity and 1.8 kv using a BIO-RAD Gene Pulser® II device (BIO-RAD, Hercules, Calif.).

example 3

Construction of Ti Plasmids with an Antibiotic Selectable Marker Gene

[0097] To select Ti plasmids in Rhizobium spp., a homologous sequence was amplified from a corresponding Ti plasmid and inserted into a kanamycin resistance vector. The homologous sequence was used to integrate the kanamycin resistance gene into the Ti plasmid by homologous recombination.

[0098] To construct the pTiBo542C plasmid, the entire virC gene (Genbank accession number AB027257) from the AGL0 Agrobacterium strain was amplified with PCR using the following primers 5′ ACAATAATGTGTGTTGTTAAGTCTTGTTGC 3′ (Xd683 SEQ ID NO:3) and 5′ CTCAAACCTACACTCAATATTTGGTGAG 3′ (Xd684 SEQ ID NO:4) and Pfu polymerase (STRATAGENE, La Jolla, Calif.) and inserted into the TOPO cloning blunt vector (Invitrogen Carlsbad, Calif.) giving rise to an intermediate vector pMON67402 The intermediate vector was further ligated to a trfA fragment from pCGN11206 digested with PvuII / MscI, which resulted in construct pMON96913 (FIG. 6). The vec...

[0001] This application claims the priority of U.S. Provisional Patent Application 60 / 800,872, filed May 16, 2006, the disclosure of which is incorporated herein by reference in its entirety.BACKGROUND OF THE INVENTION

[0002] 1. Field of the Invention

[0003] The present invention relates to the field of plant biotechnology. In particular, the invention relates to methods for producing transgenic plants and plant cells by using non-Agrobacterium bacterial species.

[0004] 2. Description of Related Art

[0005] Agrobacterium spp., members of the Rhizobiales, are common soil bacteria, along with Rhizobium spp., Mesorhizobium spp., Sinorhizobium spp., and related species and genera. A number of wild-type and disarmed (non-pathogenic) strains of Agrobacterium tumefaciens and Agrobacterium rhizogenes harboring Ti or Ri plasmids can be used for gene transfer into plants. Phytohormone synthesis genes located in the T-DNA of wild type Agrobacteria harboring a Ti or Ri plasmid are expressed in pl...

Examples

example 1

Rhizobium and Agrobacterium Strains

[0095]Agrobacterium tumefaciens AGL0 was obtained from ATCC (ATCC Number: BAA-100™, Lazo et al., 1991). Rhizobium leguminosarum strain Madison and Sinorhizobium meliloti SD630 were isolated from weed clover in a home garden in Madison, Wis., USA, and confirmed by sequencing the PCR product of a 16S rRNA amplified with the following primers: 5′ GAGAGTTTGATCCTGGCTCAG 3′ (Xd578; SEQ ID NO:1) and 5′ AAGGAGGTGATCCAGCCGCAG 3′ (Xd579; SEQ ID NO:2). Other Rhizobium strains were obtained from USDA Rhizobium collection center (Table 1). Rhizobium strains were grown in TY or MAG medium and Agrobacterium in LB medium. Strains are shown below and 16s rRNA sequences amplified in strains isolated are provided as SEQ ID NOs:24-30.

TABLE 1Agrobacterium and Rhizobium strainsStrain NameTi plasmidSourceA. tumefaciens AGL0pTiBo542ATCC; Lazo et al., 1991A. tumefaciens LBA4404pAL4404Hoekema et al., 1983A. tumefaciens AGL0CpTiBo542C (kanR)This studyA. tumefaciens AGL0Gp...

example 2

Transformation of Agrobacterium

[0096] The Agrobacterium competent cells were prepared by washing a log phase culture in LB medium with chilled deionized water and 10% glycerol, and stored at −80° C. Fifty microliters of thawed competent cells were mixed with 1 or 2 μl DNA on ice and electroporated in 1 mm gap curvet with 200 ohm resistance, 25 μF capacity and 1.8 kv using a BIO-RAD Gene Pulser® II device (BIO-RAD, Hercules, Calif.).

example 3

Construction of Ti Plasmids with an Antibiotic Selectable Marker Gene

[0097] To select Ti plasmids in Rhizobium spp., a homologous sequence was amplified from a corresponding Ti plasmid and inserted into a kanamycin resistance vector. The homologous sequence was used to integrate the kanamycin resistance gene into the Ti plasmid by homologous recombination.

[0098] To construct the pTiBo542C plasmid, the entire virC gene (Genbank accession number AB027257) from the AGL0 Agrobacterium strain was amplified with PCR using the following primers 5′ ACAATAATGTGTGTTGTTAAGTCTTGTTGC 3′ (Xd683 SEQ ID NO:3) and 5′ CTCAAACCTACACTCAATATTTGGTGAG 3′ (Xd684 SEQ ID NO:4) and Pfu polymerase (STRATAGENE, La Jolla, Calif.) and inserted into the TOPO cloning blunt vector (Invitrogen Carlsbad, Calif.) giving rise to an intermediate vector pMON67402 The intermediate vector was further ligated to a trfA fragment from pCGN11206 digested with PvuII / MscI, which resulted in construct pMON96913 (FIG. 6). The vec...

Images