Use of non-agrobacterium bacterial species for plant transformation

a technology of non-agrobacterium bacteria and plant, applied in the field of plant biotechnology, can solve the problems of low efficiency in others, inability to use certain tissues as transformation targets, and complicating analysis

Active Publication Date: 2007-11-22
MONSANTO TECH LLC
View PDF9 Cites 60 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0038] In yet another aspect of the invention, a DNA construct is provided competent for virD2-independent transfer from Rhizobia and lacking T-DNA border sequence, the construct comprising an oriT sequence and traA or mob sequence operably linked to a nucleic acid of interest. The invention further provides a Rhizobia cell transformed with such a DNA construct of claim 35, wherein the Rhizobia is selected from the group consisting of: Rhizobium spp., Sinorhizobium spp., Mesorhizobium spp., Phyllobacterium spp. Ochrobactrum spp. and Bradyrhizobium spp. In one embodiment, the Rhizobia cell is selected from the group consisting of: Rhizobium sp., Rhizobium sp. NGR234, Rhizobium leguminosarum Madison, R. leguminosarum USDA2370, R. leguminosarum USDA2408, R. leguminosarum USDA2668, R. leguminosarum 2370G, R. leguminosarum 2370LBA, R. leguminosarum 2048G, R. leguminosarum 2048LBA, R. leguminosarum bv. phaseoli, R. leguminosarum bv. phaseoli 2668G, R. leguminosarum bv. phaseoli 2668LBA, R. leguminosarum RL542C, R. leguminosarum bv. viciae, R. leguminosarum bv. trifolii, Rhizobium etli sUSDA 9032, R. etli bv. phaseoli, Rhizobium tropici, Mesorhizobium sp., Mesorhizobium loti ML542G, M. loti ML4404, Sinorhizobium sp., Sinorhizobium meliloti SD630, S. meliloti USDA1002, Sinorhizobium fredii USDA205, S. fredii SF542G, S. fredii SF4404, S. fredii SM542C, Bradyrhizobium sp., Bradyrhizobium japonicum USDA 6, and B. japonicum USDA 110. In specific embodiments, the cell is a Rhizobium leguminosarum cell, and in still further embodiments, may be a R. leguminosarum bv. trifolii, R. leguminosarum bv. phaseoli or Rhizobium leguminosarum. bb. viciae cell.

Problems solved by technology

However, a number of plant species are recalcitrant to Agrobacterium-mediated transformation, and efficiency is low in others.
Additionally, since A. tumefaciens enters plant tissues at wound sites, and does not naturally infect unwounded tissues, the use of certain tissues as transformation targets is not available.
However the presence of Agrobacteria was not ruled out as a possibility in some inoculated plants, complicating the analysis.
In addition, transformation efforts in rice, tobacco, and Arabidopsis with non-Agrobacterium bacterial strains have to date been hampered by low transformation efficiencies.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of non-agrobacterium bacterial species for plant transformation
  • Use of non-agrobacterium bacterial species for plant transformation
  • Use of non-agrobacterium bacterial species for plant transformation

Examples

Experimental program
Comparison scheme
Effect test

example 1

Rhizobium and Agrobacterium Strains

[0095]Agrobacterium tumefaciens AGL0 was obtained from ATCC (ATCC Number: BAA-100™, Lazo et al., 1991). Rhizobium leguminosarum strain Madison and Sinorhizobium meliloti SD630 were isolated from weed clover in a home garden in Madison, Wis., USA, and confirmed by sequencing the PCR product of a 16S rRNA amplified with the following primers: 5′ GAGAGTTTGATCCTGGCTCAG 3′ (Xd578; SEQ ID NO:1) and 5′ AAGGAGGTGATCCAGCCGCAG 3′ (Xd579; SEQ ID NO:2). Other Rhizobium strains were obtained from USDA Rhizobium collection center (Table 1). Rhizobium strains were grown in TY or MAG medium and Agrobacterium in LB medium. Strains are shown below and 16s rRNA sequences amplified in strains isolated are provided as SEQ ID NOs:24-30.

TABLE 1Agrobacterium and Rhizobium strainsStrain NameTi plasmidSourceA. tumefaciens AGL0pTiBo542ATCC; Lazo et al., 1991A. tumefaciens LBA4404pAL4404Hoekema et al., 1983A. tumefaciens AGL0CpTiBo542C (kanR)This studyA. tumefaciens AGL0Gp...

example 2

Transformation of Agrobacterium

[0096] The Agrobacterium competent cells were prepared by washing a log phase culture in LB medium with chilled deionized water and 10% glycerol, and stored at −80° C. Fifty microliters of thawed competent cells were mixed with 1 or 2 μl DNA on ice and electroporated in 1 mm gap curvet with 200 ohm resistance, 25 μF capacity and 1.8 kv using a BIO-RAD Gene Pulser® II device (BIO-RAD, Hercules, Calif.).

example 3

Construction of Ti Plasmids with an Antibiotic Selectable Marker Gene

[0097] To select Ti plasmids in Rhizobium spp., a homologous sequence was amplified from a corresponding Ti plasmid and inserted into a kanamycin resistance vector. The homologous sequence was used to integrate the kanamycin resistance gene into the Ti plasmid by homologous recombination.

[0098] To construct the pTiBo542C plasmid, the entire virC gene (Genbank accession number AB027257) from the AGL0 Agrobacterium strain was amplified with PCR using the following primers 5′ ACAATAATGTGTGTTGTTAAGTCTTGTTGC 3′ (Xd683 SEQ ID NO:3) and 5′ CTCAAACCTACACTCAATATTTGGTGAG 3′ (Xd684 SEQ ID NO:4) and Pfu polymerase (STRATAGENE, La Jolla, Calif.) and inserted into the TOPO cloning blunt vector (Invitrogen Carlsbad, Calif.) giving rise to an intermediate vector pMON67402 The intermediate vector was further ligated to a trfA fragment from pCGN11206 digested with PvuII / MscI, which resulted in construct pMON96913 (FIG. 6). The vec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Magnetic fieldaaaaaaaaaa
Magnetic fieldaaaaaaaaaa
Volumeaaaaaaaaaa
Login to View More

Abstract

The invention relates to methods for Rhizobia-mediated genetic transformation of plant cells, including soybean, canola, corn, and cotton cells. These include both VirD2-dependent and VirD2-independent methods. Bacterial species utilized include strains of Rhizobium sp., Sinorhizobium sp., and Mesorhizobium sp. Vectors for use in such transformation are also disclosed.

Description

[0001] This application claims the priority of U.S. Provisional Patent Application 60 / 800,872, filed May 16, 2006, the disclosure of which is incorporated herein by reference in its entirety.BACKGROUND OF THE INVENTION [0002] 1. Field of the Invention [0003] The present invention relates to the field of plant biotechnology. In particular, the invention relates to methods for producing transgenic plants and plant cells by using non-Agrobacterium bacterial species. [0004] 2. Description of Related Art [0005]Agrobacterium spp., members of the Rhizobiales, are common soil bacteria, along with Rhizobium spp., Mesorhizobium spp., Sinorhizobium spp., and related species and genera. A number of wild-type and disarmed (non-pathogenic) strains of Agrobacterium tumefaciens and Agrobacterium rhizogenes harboring Ti or Ri plasmids can be used for gene transfer into plants. Phytohormone synthesis genes located in the T-DNA of wild type Agrobacteria harboring a Ti or Ri plasmid are expressed in pl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01H1/00C12N1/20C12N15/82
CPCC12N15/8205C12N15/8202C12R1/41C12R2001/41C12N1/205A01H6/542
InventorYE, XUDONGSHEN, JUNJIANGWILLIAMS, EDWARD
OwnerMONSANTO TECH LLC