Method for determining ion channel activity of a substance
a technology method, which is applied in the direction of microorganism testing/measurement, biochemistry apparatus and processes, enzymes, etc., can solve the problems of reducing the value of therapeutic agents, too tedious and time-consuming methods for routine screening of ion channel activity, and relatively slow and inefficient screening assays
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
[0044]This example demonstrates the functional expression of Vpu in E. coli host cells and the detection of changes in the permeability of the plasma-membrane of the host cells to proline by detecting leakage of proline from the host cells using the cross-feeding method. It will be understood that the same methods can be performed to demonstrate or determine the ion channel activity of peptides, polypeptides or protein other than Vpu.
Construction of recombinant plasmids p2GEXVpu and pPL-Vpu
[0045]The open reading frame encoding Vpu (SEQ ID No. 1—FIG. 1A) was amplified by PCR from a cDNA clone of an Nde1 fragment of the HIV-1 genome (isolate HXB2, a gift from Dr N. Deacon, McFarlane Burnet Centre, Melbourne, Australia). Native Pfu DNA polymerase (Stratagene; 0.035 U / μl) was chosen to catalyse the PCR reaction to minimise possible PCR introduced errors by virtue of the enzyme's proofreading activity. The 5′, sense, primer (AGTAGGATCCATGCACCTATACC—SEQ ID No.2) introduces a BamH1 site (u...
example 2
[0054]This example demonstrates the functional expression of Vpu in E. coli cells and the detection of changes in the permeability of the plasma membrane of the host cell to adenine by detecting failure to thrive of the host cells when grown on minimal medium plates lacking adenine. As with Example 1, it will be understood that the same methods can be performed to demonstrate or determine the ion channel activity of peptides, polypeptides or proteins other than Vpu.
[0055]The same expression and control plasmids are used as described in Example 1 above (pPL-Vpu and pPL451, respectively). When cells of the E. coli strain XL-1 Blue containing the Vpu expression plasmid pPLVpu are incubated at 37° C. on minimal medium plates the host cells fail to grow (FIG. 5). Because of an undefined temperature sensitive mutation in the adenine biosynthesis pathway of E. coli strain XL-1 Blue, this strain is unable to up-regulate adenine biosynthesis in response to adenine leakage induced as a result...
example 3
[0058]This example demonstrates the use of the adenine growth-dependence assay to detect mutant forms of the Vpu protein affecting channel activity.
[0059]A site directed mutation was introduced to the Vpu gene so as to change the amino acids Arg and Lys as positions 37 and 38 to Glu and Ile in the protein expressed from the mutated gene (called “RK37DI mutant Vpu”). In electro-physiological assay of channel function this mutation was shown to reduce the conductance of the ion channels formed to approx 20% of that of the wild-type channels (3 picosiemens versus 15 picosiemens, respectively). FIG. 6B shows a comparison of the size of the currents produced by mutant and wild-type channels in planar lipid bilayers.
[0060]On minimal media plates (containing no adenine—as per FIG. 5), cells containing the plasmid encoding the RK37DI mutant Vpu had a partial growth phenotype compared to cells containing the wild-type Vpu gene (which don't grow at all) and to cells containing no Vpu gene (in...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Current | aaaaa | aaaaa |
| Current | aaaaa | aaaaa |
| Current | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More