Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nematophagous bacillus extracellular infectious alkaline serine protease gene and its application

A technology of serine protease and bacillus, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems that have not been reported publicly, and achieve high safety and good insecticidal effect

Inactive Publication Date: 2008-01-02
YUNNAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Through literature search, there is no public report identical with the present invention

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nematophagous bacillus extracellular infectious alkaline serine protease gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Example 1: Gene Cloning of Extracellular Invasive Alkaline Serine Protease

[0017] 1. Primer design

[0018] After the electrophoretic pure alkaline serine protease purified from Bacillus nematodes was electrotransferred to PVDF membrane, it was sent to the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences for N-terminal amino acid detection, and the sequencing result was AQSVPYGVSQ. The N-terminal amino acid detection results were searched on NCBI, and it was found that it had a high homology with the alkaline serine protease subtilisin BPN' (ID: P00782) derived from B. amyloliquefaciens. The degenerate primers GGAGAGGATAAAGAGTGAGAGGCAAA and CTGAGCTGCCGCCTGTACGT were designed according to the results of protein homology comparison for the amplification of the target protease gene.

[0019] 2. Gene cloning

[0020] The genomic DNA extracted from Bacillus nematodes was used as a template, and the degenerate primers designed above were used as PC...

Embodiment 2

[0024] Example 2: Heterologous expression of extracellular invasive alkaline serine protease

[0025] 1) Construction of recombinant expression plasmid:

[0026] According to the target alkaline serine protease gene design a pair of primers containing NcoI and XhoI in the upstream and downstream respectively:

[0027] 5'-CCATGGGCCGCTGCAACCGGAACAG-3'; 5'-CTCGA

[0028] GCAATCCAACTGCATTCCAGGC-3', the amplified DNA piece after PCR

[0029] The segments were recovered, digested, connected with the E. coli expression vector pET30a, transformed into the E. coli competent cell DH5α, and screened to obtain the recombinant plasmid expressing alkaline serine protease.

[0030] II) Protein induced expression and SDS-PAGE:

[0031] 1. Transform the expression host strain BL21 with the recombinant plasmid, and use BL21 containing the plasmid pET30a as the control strain to induce expression.

[0032] 2. Pick the transformed colony and inoculate it into 2ml of LB medium containing 50μg / ...

Embodiment 3

[0046] Example 3: Construction of Infectious Alkaline Serine Protease Gene Knockout Mutant

[0047] 1. Digest the recombinantly expressed plasmid with ClaI and PstI to obtain a 295bp fragment, and connect it to the same double-digested integration vector pCP115.

[0048] 2. The ligation product was transformed into competent Escherichia coli JM109, and positive transformants were screened by colony PCR amplification and enzyme digestion verification.

[0049] 3. Prepare the competent cells of the nematicidal Bacillus and transfer the above-mentioned positive transformants into the competent cells: take the recipient bacteria and inoculate them in the BY culture medium, and cultivate them at 37° C. to the early and middle stages of logarithmic growth. At this time, the OD620 should be around 0.4, and the culture time should be about 4 to 5 hours. Centrifuge the cultured bacterial solution, discard the supernatant, wash the bacteria once with growth medium (GM solution), and th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an extracellular infectivity basic serine proteinase gene of a nematology bacillus and the application in the biotechnology field. The gene is got by colony from the nematology bacillus, wherein the length of open reading frame is 1146bp, the gene codes a protein with 382 amino acid residues which comprise a signal peptide with 30 amino acid residues, a front peptide with 77 amino acid residues and a mature peptide with 275 amino acid residues. The recombinant protein of the gene in the bacillus coli BL21 can degrade the body wall of the nematization and can kill the active of the nematization, and removing the mutant shows the reduction of the ptoteinase active and a large lost of the insecticidal activity. The basic serine proteinase gene is an important toxicity factor in the process that nematology bacillus infects nematization. The gene can be used to research the biochemistry essentiality of proteinase in the nfecting nematization process, which can be regarded as the target gene acquiring highly effective proof strain. The invention has the high safety and the good insecticidal effect.

Description

Technical field: [0001] The invention relates to an extracellular invasive alkaline serine protease gene of nematode bacillus and its application, which belongs to the field of biotechnology. Background technique: [0002] Plant parasitic nematodes have the characteristics of wide geographical distribution and diverse host species, and can easily cause secondary fungal or bacterial infection of plants that have already suffered from nematode diseases, thus causing great harm to crops, forest trees and edible fungi. However, the chemical control we rely on today is being gradually restricted due to the damage to the environment and the impact on the safety of humans and animals. Therefore, the need for biological control of pathogenic nematodes is increasingly evident. During the nematode infestation process, whether it is the worm body itself or the nematode eggs, the body wall or egg shell covering the surface is an important protective structure for nematodes to prevent in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/57C12N9/54C12N1/21
Inventor 黄晓玮张克勤牛秋红
Owner YUNNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com