Nematophagous bacillus extracellular infectious alkaline serine protease gene and its application
A technology of serine protease and bacillus, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems that have not been reported publicly, and achieve high safety and good insecticidal effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0016] Example 1: Gene Cloning of Extracellular Invasive Alkaline Serine Protease
[0017] 1. Primer design
[0018] After the electrophoretic pure alkaline serine protease purified from Bacillus nematodes was electrotransferred to PVDF membrane, it was sent to the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences for N-terminal amino acid detection, and the sequencing result was AQSVPYGVSQ. The N-terminal amino acid detection results were searched on NCBI, and it was found that it had a high homology with the alkaline serine protease subtilisin BPN' (ID: P00782) derived from B. amyloliquefaciens. The degenerate primers GGAGAGGATAAAGAGTGAGAGGCAAA and CTGAGCTGCCGCCTGTACGT were designed according to the results of protein homology comparison for the amplification of the target protease gene.
[0019] 2. Gene cloning
[0020] The genomic DNA extracted from Bacillus nematodes was used as a template, and the degenerate primers designed above were used as PC...
Embodiment 2
[0024] Example 2: Heterologous expression of extracellular invasive alkaline serine protease
[0025] 1) Construction of recombinant expression plasmid:
[0026] According to the target alkaline serine protease gene design a pair of primers containing NcoI and XhoI in the upstream and downstream respectively:
[0027] 5'-CCATGGGCCGCTGCAACCGGAACAG-3'; 5'-CTCGA
[0028] GCAATCCAACTGCATTCCAGGC-3', the amplified DNA piece after PCR
[0029] The segments were recovered, digested, connected with the E. coli expression vector pET30a, transformed into the E. coli competent cell DH5α, and screened to obtain the recombinant plasmid expressing alkaline serine protease.
[0030] II) Protein induced expression and SDS-PAGE:
[0031] 1. Transform the expression host strain BL21 with the recombinant plasmid, and use BL21 containing the plasmid pET30a as the control strain to induce expression.
[0032] 2. Pick the transformed colony and inoculate it into 2ml of LB medium containing 50μg / ...
Embodiment 3
[0046] Example 3: Construction of Infectious Alkaline Serine Protease Gene Knockout Mutant
[0047] 1. Digest the recombinantly expressed plasmid with ClaI and PstI to obtain a 295bp fragment, and connect it to the same double-digested integration vector pCP115.
[0048] 2. The ligation product was transformed into competent Escherichia coli JM109, and positive transformants were screened by colony PCR amplification and enzyme digestion verification.
[0049] 3. Prepare the competent cells of the nematicidal Bacillus and transfer the above-mentioned positive transformants into the competent cells: take the recipient bacteria and inoculate them in the BY culture medium, and cultivate them at 37° C. to the early and middle stages of logarithmic growth. At this time, the OD620 should be around 0.4, and the culture time should be about 4 to 5 hours. Centrifuge the cultured bacterial solution, discard the supernatant, wash the bacteria once with growth medium (GM solution), and th...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap