Unlock instant, AI-driven research and patent intelligence for your innovation.

SLC39A7 gene as genetic label of pig fat deposition description and application thereof

A genetic marker, pig fat technology, applied in the field of pig breeding and molecular assisted selection of pigs, can solve problems such as reports that have not yet been applied

Inactive Publication Date: 2008-01-30
HUAZHONG AGRI UNIV
View PDF1 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] So far, there is no report on the gene SLC39A7 DNA genetic marker related to pig fat deposition traits and its application in polymorphism analysis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SLC39A7 gene as genetic label of pig fat deposition description and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Obtaining of SLC39A7 gene fragment and establishment of polymorphism detection method

[0024] Two different genotype pig breeds, "Large White Pig" with European blood origin and "Meishan Pig" with Chinese local pig blood origin, were selected as test materials. According to the swine SLC39A7 gene genome sequence (GeneBank accession number: CT737383), the following primers and primers were designed The sequence is as follows:

[0025] Forward primer F: ATCCTGCTGAGTTTTGCTTCG

[0026] Reverse primer R: TGGGGATGGACACATTGAGAC

[0027] PCR amplification was carried out in the genomic DNA of large white pig and Meishan pig with the above primers. The PCR reaction system was 25μl, the template DNA was 50ng, the concentration of dNTPs was 200μmol / L, the concentration of each primer was 0.4μmol / L, and 3U Taq DNA Polymerase (purchased from BiostarInternational, Canada), add deionized water to a total volume of 25μl; PCR reaction program: 94°C pre-denaturation 4min; then 94...

Embodiment 2

[0030]Example 2: Application of the cloned genetic markers of the present invention in the detection of polymorphism in pigs of different genotypes

[0031] Using the genetic markers of the present invention, two foreign pig herds from European blood (Large white pigs and Landrace pigs) and 6 pig herds from Chinese local pig blood (Wannan Hua pig, Bamei pig, Jianli pig, Yangxin pig, The HpaII-RFLP polymorphism of the third exon of SLC39A7 was detected in Meishan pigs and Exi black pigs. The detection results are shown in Table 1. Among the several pig breeds tested, the gene frequencies of the dominant A alleles in the European blood-related pig breeds Large White and Landrace pigs were 0.734 and 0.679, respectively, and the Chinese local pig blood-related pigs Wannan Hua pig, Bamei pig, The gene frequencies of the dominant B allele in Jianli, Yangxin, Meishan, and Western Hubei black pigs are 0.917, 0.667, 0.714, 1, 0.738, and 0.615, respectively. Among the above-mentioned Europe...

Embodiment 3

[0034] Example 3: Application of the cloned genetic markers of the present invention in the correlation analysis of pig fat deposition traits

[0035] (1) Single label analysis

[0036] In order to determine whether the SLC39A7 gene polymorphism is related to pig phenotypic differences, 293 large white pigs × Meishan pigs F2 resource population established by the Key Open Laboratory of Pig Genetics and Breeding of the Ministry of Agriculture of Huazhong Agricultural University, Wuhan City, Hubei Province, China were selected as the experimental materials. The HpaII-RFLP method established in Example 2 was used for polymorphism detection, and the correlation between different genotypes of pig SLC39A7 gene HpaII-RFLP and pig carcass traits was analyzed. The glm program of SAS statistical software (SAS Institute Inc, Version 8.0) is used for single-label analysis of variance, and the model is as follows:

[0037] y ijkl =μ+g i +f j +s k +y l +βcov ijkl +e ijkl

[0038] y ijkl Is the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention pertains to the technical field of pig genetics and breeding and assistant selection by molecular marker, in particular to a genetic marker for screening SLC39A7 gene of pig fat deposition trait. The genetic marker has a nucleotide sequence as shown in sequence table SEQ ID NO.1 and SEQ ID NO. 2. A missense mutation of A250-G250 is shown in the place of 250bp in the SEQ ID NO.1, which causes the coded amino acid to be changed from arginine to glycine and causes polymorphism of HpaII-RFLP. The genetic marker of the invention is adopted to do relative analysis of relative fat deposition trait of foreign pig variety and local variety in China. The invention also discloses a detection method of SNP typing of a third exon in SLC39A7 gene and provides the novel genetic marker and the detection method for assistant selection by molecular marker.

Description

Technical field [0001] The present invention relates to the technical field of pig breeding and molecular-assisted selection of pigs, in particular to the cloning of a gene SLC39A7 DNA fragment related to pig fat deposition traits and its application as a genetic marker for pig fat deposition traits, providing a way for pig marker-assisted selection A new mark and a new method. Background technique [0002] Selective breeding of animals based on the breeding value estimated by the phenotypic value of production traits has greatly promoted the genetic improvement of livestock production traits. Since the 1990s, with the advancement of molecular biology technology and its application in the pig field, molecular breeding technologies such as molecular marker-assisted selection and infiltration with molecular markers as the core have gradually emerged. These technologies are combined with conventional breeding, greatly Speed ​​up the pig breeding process. Genes or markers that can be...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11C12N15/12
Inventor 左波马志雄陈朝国熊远著
Owner HUAZHONG AGRI UNIV