SLC39A7 gene as genetic label of pig fat deposition description and application thereof
A genetic marker, pig fat technology, applied in the field of pig breeding and molecular assisted selection of pigs, can solve problems such as reports that have not yet been applied
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1: Obtaining of SLC39A7 gene fragment and establishment of polymorphism detection method
[0024] Two different genotype pig breeds, "Large White Pig" with European blood origin and "Meishan Pig" with Chinese local pig blood origin, were selected as test materials. According to the swine SLC39A7 gene genome sequence (GeneBank accession number: CT737383), the following primers and primers were designed The sequence is as follows:
[0025] Forward primer F: ATCCTGCTGAGTTTTGCTTCG
[0026] Reverse primer R: TGGGGATGGACACATTGAGAC
[0027] PCR amplification was carried out in the genomic DNA of large white pig and Meishan pig with the above primers. The PCR reaction system was 25μl, the template DNA was 50ng, the concentration of dNTPs was 200μmol / L, the concentration of each primer was 0.4μmol / L, and 3U Taq DNA Polymerase (purchased from BiostarInternational, Canada), add deionized water to a total volume of 25μl; PCR reaction program: 94°C pre-denaturation 4min; then 94...
Embodiment 2
[0030]Example 2: Application of the cloned genetic markers of the present invention in the detection of polymorphism in pigs of different genotypes
[0031] Using the genetic markers of the present invention, two foreign pig herds from European blood (Large white pigs and Landrace pigs) and 6 pig herds from Chinese local pig blood (Wannan Hua pig, Bamei pig, Jianli pig, Yangxin pig, The HpaII-RFLP polymorphism of the third exon of SLC39A7 was detected in Meishan pigs and Exi black pigs. The detection results are shown in Table 1. Among the several pig breeds tested, the gene frequencies of the dominant A alleles in the European blood-related pig breeds Large White and Landrace pigs were 0.734 and 0.679, respectively, and the Chinese local pig blood-related pigs Wannan Hua pig, Bamei pig, The gene frequencies of the dominant B allele in Jianli, Yangxin, Meishan, and Western Hubei black pigs are 0.917, 0.667, 0.714, 1, 0.738, and 0.615, respectively. Among the above-mentioned Europe...
Embodiment 3
[0034] Example 3: Application of the cloned genetic markers of the present invention in the correlation analysis of pig fat deposition traits
[0035] (1) Single label analysis
[0036] In order to determine whether the SLC39A7 gene polymorphism is related to pig phenotypic differences, 293 large white pigs × Meishan pigs F2 resource population established by the Key Open Laboratory of Pig Genetics and Breeding of the Ministry of Agriculture of Huazhong Agricultural University, Wuhan City, Hubei Province, China were selected as the experimental materials. The HpaII-RFLP method established in Example 2 was used for polymorphism detection, and the correlation between different genotypes of pig SLC39A7 gene HpaII-RFLP and pig carcass traits was analyzed. The glm program of SAS statistical software (SAS Institute Inc, Version 8.0) is used for single-label analysis of variance, and the model is as follows:
[0037] y ijkl =μ+g i +f j +s k +y l +βcov ijkl +e ijkl
[0038] y ijkl Is the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 