Method for rapidly detecting grouper irido virus

An iridescent virus, detection method technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problem of complex LAMP primer design and other problems, and achieve the effect of rapid detection

Inactive Publication Date: 2008-05-07
SUN YAT SEN UNIV
View PDF0 Cites 27 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0017] The design of LAMP primers is much more complicated than conventional PCR

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapidly detecting grouper irido virus
  • Method for rapidly detecting grouper irido virus
  • Method for rapidly detecting grouper irido virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1 Establishment of LAMP detection method

[0062] 1. SGIVORF-014L cloning and plasmid template construction

[0063] 1.1 Materials and methods

[0064] 1.1.1 Materials

[0065] 1.1.1.1 Viruses and Cells

[0066] Grouper iridovirus SGIV (Singapore grouper iridovirus SGIV) is preserved by our laboratory.

[0067] GP cells (Grouper embryo cells) were subcultured and preserved by our laboratory.

[0068] 1.1.1.2 Plasmid vectors and recipient strains

[0069] Plasmid vector: pMD18-T (Figure 1), purchased from TaKaRa Company.

[0070] Recipient bacteria: Escherichia coli strain JM109, genotype: recA supE44 endA1 hsdR17 gyrA96recA1 thiΔ(lac-proAB)F'[traD36proAB+lacI1 lacZΔM15.

[0071] 1.1.1.3 Medium

[0072] LB liquid medium: 10g of trytone; 5g of yeast extract; 10g of NaCl, add 800mL of distilled water, adjust the pH to 7.2-7.4 with 5M NaOH, dilute to 1000mL, aliquot, autoclave, 4 Store at ℃.

[0073] LB solid medium: Add imported agar powder to LB liquid me...

Embodiment 2

[0290] LAMP primers were designed according to the sequence of SGIV ORF-014L, and the primers were designed and screened using Primer Explorer V3 software (Fujitsu). The primer sequences obtained were:

[0291] F3: GCACGAGTATACGGCCTCTG

[0292] B3: CGGCTACCAGCATCCAAT

[0293] FIP:

[0294] GACTACGGGTTCGATGGCTGC-TTTT-AGACGATTGCGCATGAAACA

[0295] BIPs:

[0296] ACGGGAGGAAACTTGTGCTGAT-TTTT-ATGGCCCGTAGAAGTCAGT

[0297] LF: TCGCGGTTCGGGTCATCAT

[0298] LB: TGCTGGAACGTGCAAAACCG

[0299] According to the selected primers, the 145-359bp fragment of SGIV ORF-014L sequence was successfully amplified, and the region was 215bp in total.

[0300] The LAMP product has a Ladder-like structure in the gel. In order to determine the specificity of the amplified product, the restriction endonuclease MstI was used to digest and identify the protein between F2 and F1c. site, the resulting fragments were consistent with the predicted sizes (218bp and 187bp) (Fig. 4). The specificity of t...

Embodiment 3

[0308] Example 3 LAMP amplification technology detects GP cells infected by SGIV

[0309] SGIV infected GP cells, and after more than 70% of GP cells appeared CPE, the infected cells and healthy control cells were collected. Whole-genome DNA was extracted for LAMP amplification and conventional PCR amplification. Plasmid pT-014L was used as a positive control, and autoclaved water was a negative control.

[0310] The detection of SGIV by LAMP amplification has good specificity, which is consistent with the results of conventional PCR detection, as shown in Figure 8.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fast detection method for grouper iridovirus, firstly proposing a loop-mediated isothermal nucleic acid amplifying detection applied for the detection of grouper iridovirus, which comprises the steps as follows: (1)a ORF-014L is cloned and a recombinant plasmid template containing ORF-014L is constructed; (2)primer design, primer sequence; (3)amplification, the reaction temperature is 63-65 DEG C, and the reaction time 20-60mins. The LAMP detection technique of the invention can rapidly detect SGIV, the transcriptional expression of SGV 014L in cells, the grouper tissue infected by SGIV, and the GP cells infected by SGIV; the sensitivity of the invention is three orders of magnitude higher than Nested PCR, reaching to six point six copies.

Description

technical field [0001] The invention relates to the technical field of grouper iridescent virus detection, in particular to a method for rapidly detecting grouper iridescent virus. Background technique [0002] After 2000, a brand-new nucleic acid amplification technology appeared in Japan—loop-mediated isothermal amplification LAMP (loop-mediated isothermal amplification) technology. LAMP is a sensitive strand displacement nucleic acid amplification technique, which can amplify the target DNA from several copies to 10 copies within one hour under constant temperature conditions (about 65°C). 9 copies (Tsugunori Notomi et al., 2000). LAMP technology amplifies and detects target nucleic acid fragments, generally 200-300bp is appropriate. The general experimental process includes: GeneBank search for target gene fragments (and use BLAST to determine the homology of this fragment with genes of other species), artificial or online design of primers Group, primer synthesis, Bst...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68
Inventor秦启伟毛新亮公杰崔化春
OwnerSUN YAT SEN UNIV