Anti-CD33 engineering antibody for target conjugated marrow series leukemia cell and its expression vector and use

A myeloid leukemia and targeted combination technology, which is applied in the field of engineering antibodies, can solve problems such as limiting drug application doses, tumor cell resistance to chemotherapy, and toxic and side effects in normal tissues, achieving rapid blood circulation and systemic clearance, tumor/ The effect of high normal tissue distribution rate and less immune rejection reaction

Inactive Publication Date: 2008-07-02
INST OF HEMATOLOGY & BLOOD HOSPITAL CHINESE ACAD OF MEDICAL SCI
View PDF1 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main obstacle to the current treatment of AML is the drug resistance of tumor cells to chemotherapy, and the toxic side effects of traditional chemotherapy on normal tissues also limit the application dose of drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-CD33 engineering antibody for target conjugated marrow series leukemia cell and its expression vector and use
  • Anti-CD33 engineering antibody for target conjugated marrow series leukemia cell and its expression vector and use
  • Anti-CD33 engineering antibody for target conjugated marrow series leukemia cell and its expression vector and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Cloning of light and heavy chain variable region genes of anti-CD33 monoclonal antibody

[0029] Application of RT-PCR method to amplify the light and heavy chain variable region genes of anti-CD33 antibody from anti-CD33 monoclonal antibody HIM3-4 hybridoma cells:

[0030] (1) RNA extraction: adopt Trizol one-step method, 1) get about 10 hybridoma cells 6 , add 1ml Trizol, mix by pipetting, and let stand at room temperature for 5 minutes. 2) Add 0.2ml of chloroform, shake vigorously for 15 seconds, and let stand at room temperature for 2-3 minutes. 3) Centrifuge at 12000 rpm at 4°C for 15 minutes. 4) Take the supernatant, add 0.5ml of isopropanol and let stand at room temperature for 15 minutes. 5) Centrifuge at 12000 rpm at 4°C for 15 minutes. 6) Discard the supernatant, add 1ml of 75% ethanol to wash, centrifuge at 7500rpm, 4°C for 5 minutes. 7) Discard the supernatant, dry the pellet, and add 30 μL of DEPC-treated water to dissolve the RNA.

[0031]...

Embodiment 2

[0036] Example 2: Construction of single-chain antibody gene expression vector pET28a ScFv

[0037] Primers for VH and VL gene amplification and splicing were designed and synthesized according to the gene sequences of the variable regions of the light and heavy chains.

[0038] Light chain upstream: GACATTGTGATGACCCAGTCTc

[0039] Light chain downstream: ACC AGA TCC ACC TCC ACC CGA GCC ACC GCC ACCCCGTTTCAGTCCAGCTTGGTCCC

[0040] Heavy chain upstream: TCG GGT GGA GGT GGA TCT GGT GGT GGC GGT TCGGAGGTGAAGCTTCAGCAATCAGGA

[0041] Downstream of the heavy chain: TGAAGAGACAGTGACCGTGGT

[0042] A BamH I restriction site was added to the 5' end of the upstream light chain, and an Xho I restriction site was added to the 3' end of primer 4. From the constructed pMD-18T19-VH and pMD-18T19-VL vectors, the VH and VL fragments were amplified by PCR, and after recovery, the anti-CD33 ScFv gene fragments were amplified by PCR through the overlapping extension splicing method ( figure ...

Embodiment 3

[0043] Example 3: Expression, purification and renaturation of anti-CD33 ScFv antibody fragments

[0044] (1) Transform Escherichia coli Rosseta with the successfully constructed expression vector PET-28a(+), pick a single colony and inoculate it in 5 mL of LB medium containing 34 μg / mL chloramphenicol and 50 μg / mL kanamycin, at 37 °C Shake culture at 200r / min overnight, dilute the overnight bacterial solution with 1:100 the next day, continue to shake until OD550 is between 0.6-0.8, add inducer IPTG to a final concentration of 0.5mmol / L, and shake on a shaker at 37°C. Shake for 5 hours to stop the induction. Take 100ul of bacterial liquid, centrifuge, discard the supernatant, keep about 20μl, then resuspend with 20μl 2XSDS loading buffer, boil at 100°C for 5min. Take 20 μl of the sample, detect the expressed protein by 10% SDS-PAGE, and stain with Coomassie brilliant blue. The experiment proved that the recombinant plasmid pET28a(+)ScFv was induced by IPTG to express the re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an engineered antibody that is used in targeting combination with combining myeloid leukemia cells to resist CD33 and the expression vector and application thereof, which comprises SEQ ID NO.3 heavy-chain variable region amino acid sequence and SEQ ID NO.4 light-chain variable region amino acid sequence. By applying RT-PCR technology, the light and heavy chain variable genes that resist CD33 resisting antibody is cloned successfully from hybridoma and light and heavy chain variable genes that resists CD33 antibody is cloned to prokaryotic expression vector to establish single-chain antibody that resists CD33 resisting antibody and the immunogenicity of mouse original CD33 resisting antibody is lowered, so as to be expressed efficiently in colibacillus, thus improving the output thereof and lowering the producing cost.

Description

technical field [0001] The invention relates to an engineering antibody, especially an anti-CD33 engineering antibody for targeting and binding to myeloid leukemia cells, as well as its expression vector and application. Background technique [0002] Leukemia is the most common malignant tumor of the hematopoietic system. At present, the incidence of leukemia patients in my country is increasing year by year. Survey data show that the total incidence of leukemia accounts for the ninth place in the total incidence of tumors; The incidence rate is about 4 / 100,000, accounting for about 35% of all malignant tumors in this period. On average, about 15,000 children under the age of 15 develop leukemia every year in my country; the incidence of leukemia among adolescents and adults aged 15-45 Accounting for the third place in the incidence of tumors in the same age. To reduce the fatality rate of leukemia and to develop and improve the treatment of leukemia is a focus of world medi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/18A61K39/395A61P35/02
Inventor廖晓龙陈小军王洋王敏左玉丰郭桂庆葛新顺屈浩王建祥韩忠朝
OwnerINST OF HEMATOLOGY & BLOOD HOSPITAL CHINESE ACAD OF MEDICAL SCI