Supercharge Your Innovation With Domain-Expert AI Agents!

Preparation for recombined cultivated silkworm antimicrobial peptide CM4 and purification process

A silkworm antimicrobial peptide and purification method technology, applied in the direction of peptide preparation methods, biochemical equipment and methods, chemical instruments and methods, etc., can solve the problem of low natural yield, achieve low production cost, high expression efficiency, separation and purification simple effect

Inactive Publication Date: 2008-12-10
NANJING NORMAL UNIVERSITY
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The antimicrobial peptide CM4 has a strong bactericidal effect on bacteria, fungi, protozoa, and tumor cells. It can be used as a new drug, but the low natural yield is a bottleneck

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation for recombined cultivated silkworm antimicrobial peptide CM4 and purification process
  • Preparation for recombined cultivated silkworm antimicrobial peptide CM4 and purification process
  • Preparation for recombined cultivated silkworm antimicrobial peptide CM4 and purification process

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0031] 1. Construction of multi-copy tandem expression vector of antibacterial peptide CM4:

[0032] 1.1 Design the following primers according to the sequence of the known antimicrobial peptide CM4:

[0033] pET32a-F: 5'GC GGGATCC AACGGCCGTTGGAAGATCTTTAAG 3′

[0034] pET32a-R:5′GAG AAGCTT TCATTA GCCGTTGATAGTGGCAGCCTGG3′

[0035] The amino acid sequences encoded by the italic parts of pET32a-F and pET32a-R are the hydroxylamine cleavage sites, and the underlined parts are the gene cloning sites BamH I and Hind III, respectively. At the same time, the framed sequence parts are the recognition sequences of the homologous enzymes Spe I and Nhe I respectively.

[0036] 1.2 The CM4 gene was synthesized by rPCR, and the CM4 gene was amplified by using pET32a-F and pET32a-R as primers. After recovery from rubber tapping, double enzyme digestion was performed on it and the pET32a(+) vector (purchased from Novagen) with BamH I and Hind III, and the single-copy expression vec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the genetic engineering field, in particular to the construction, expression, purification and optimal copy strain screening technologies of a domestic silkworm antibacterial peptide CM4 multi-copy expression vector. The technical proposal comprises the following steps of: using a DNA recombination technology to construct the multi-copy orthokinetic series connection expression vector pET32a-nCM4 (n is equal to 1, 2, 3...8) of the antibacterial peptide CM4, and then using a nickel column affinity chromatographic technology to purify a multi-copy antibacterial CM4 fusion protein; and using hydroxylamine to cut a TrxA-n CM4 fusion protein to obtain an antibacterial CM4 monomer. The invention adopts the genetic engineering technologies for expressing the recombination antibacterial peptide CM4 with high efficiency in a pronucleus host cell, separation and purification are simple, amplification is easy and the cost is low, thereby laying a foundation for the mass production, study and application of the antibacterial peptide.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to technologies such as the construction, expression and purification of multi-copy expression vectors for silkworm antimicrobial peptide CM4 and the screening of optimal copy strains. technical background [0002] Antimicrobial peptides are an important part of the natural immune system of all organisms. They constitute the first line of defense for higher animals to defend against foreign organisms. So far, more than 1,000 peptides with antibacterial activity have been isolated and identified. Antimicrobial peptides have a broad antibacterial spectrum, not only have killing effects on common pathogenic bacteria and protozoa, but also can inhibit the replication of influenza A virus, vesicular stomatitis virus and human immunodeficiency virus. Antimicrobial peptides work by affecting the bacterial cell membrane, and bacteria are not easy to develop drug resistance, so they are ex...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/70C07K14/435C07K1/20C07K1/14
Inventor 张双全周良范李保存
Owner NANJING NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More