Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting pine beam nematode and detecting process thereof

A detection kit and technology for pine xylophilus, applied in biochemical equipment and methods, material stimulation analysis, microbial measurement/inspection, etc., can solve the problems of many experimental links, many instruments and equipment, complex sample processing, etc., and achieve the goal of overcoming Complicated, time-consuming and highly technical effects

Active Publication Date: 2009-01-07
NANJING FORESTRY UNIV
View PDF5 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to similar morphological characteristics, the overlapping phenomenon of B. xylophilus and other nematodes brings great difficulty to accurate identification.
Second, due to the rich variety of nematodes in nature and the small size of nematodes, professional technical knowledge and skills are required to accurately identify a certain nematode, so in the actual detection process, there are often false detections and missed detections
Third, some pine logs and wood packaging materials intercepted by various quarantine inspection stations and quarantine ports have less water content and less nematode content, and most of them are larvae, so it is difficult to accurately identify them morphologically.
[0005] At present, in the molecular detection of pine wood nematode, mainly can be divided into two classes, a class is the method of traditional PCR, for example, the patent " pine wood nematode detection kit and detection method thereof " of Nanjing Agricultural University (application number: 200310106109.5 ), Yunnan Agricultural University's patent "a rapid detection method for pine wilt disease pathogenic nematode" (application number: 200510048722.5) and Ye Jianren's patent "Pine Xylophilus PCR detection specific primer pair" (application number: 200610039049.3), the above The methods all have the characteristics of requiring many instruments and equipment, complex sample processing, too many experimental links, difficult to master, and easy to introduce human errors.
The other is the method of real-time fluorescent PCR, such as the patent "a method for detecting pine wood nematode and its special primers and probes" (application number: 200310109374.9) of the Institute of Microbiology, Chinese Academy of Sciences, and the prevention and quarantine of forestry diseases and insect pests in Shanghai. Station and Nanjing Agricultural University Plant Protection Institute's patent "Pine wood nematode detection kit and its detection method" (application number: 200510026710.2), since the primers and probes used in the above detection method all come from ribosomal rDNA and microsatellite DNA, these DNA sequences are extremely conservative, which may lead to insufficient specificity and stability of primers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting pine beam nematode and detecting process thereof
  • Kit for detecting pine beam nematode and detecting process thereof
  • Kit for detecting pine beam nematode and detecting process thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Design of primers and probes

[0027] The invention obtains the Topoisomerase gene fragment specifically expressed in the pine wood nematode on the basis of constructing the suppression subtractive hybridization of the pine wood nematode and the pine wood nematode pseudo.

[0028] ACACTGAAGACTTTTAAGAACCGCGAAATGAGAATAAAGACAGCGCGCTG TGGCCCT ATATTTCATCGACAA GCTGGCTCTGAGAGCGGGAAATGAGAA AAAAGTGGACAGGCT CAAGGA ACAGCTGAAGAGGCTGAAGATTCAAAGAACGGATAAGGACGAAAACAAACAAATCGCTCTCGGCACCTCCAAACTCAACT

[0029] Design primers XC64F (5'TGGCC CTATA TTTCA TCGAC AA3') and XC64R (5'TCCTT GAGCC TGTCC ACTTT T3') according to the above sequence, and use the primers to amplify the genomic DNA of B. xylophilus to obtain the intron of the gene , the sequence is as follows:

[0030]TGGCCCTATATTTCATCGACAAGCTGGCTCTGAGAGCGGGAAATGAGAAAGATACGGACGAAGCGGCCGATACTGTGGGTTGTTGCTCGCTGAGATGCGAACATGTCACTTTGAACGAGGAATTGGACGGAAAAAAGTAGGAATTTTGGCTTAAAGTCATCTATTTTATATTGATTTAGGCATATGTTTTTGATATAAAAAA...

Embodiment 2

[0033] Embodiment 2: detection of pine wood nematode

[0034] 1. Nematode DNA extraction

[0035] Separately collected nematode samples (see Table 1) were placed in 20uL nematode lysate (50mM KCl, 10mM Tris.Cl, pH 8.3, 2.5mM MgCl 2 , 0.45% (v / v) NP40, 0.45% (v / v) Tween 20, 80μg / mL Proteinase K), treated at 65°C for 1h, 95°C for 10min, centrifuged at 16,000g for 1min, and took 2.5μL of supernatant for Real-time PCR detection.

[0036] 2. Real-time PCR detection

[0037] In a real-time fluorescent PCR reaction tube, add 5 μL Taqman 2×PCR Master Mix (Applied Biosystems), 0.5 μL TOPO-F (10 μmol), 0.5 μL TOPO-R (10 μmol), 0.5 μL TOPO-PB (10 μmol), 2.5 μL Serum template, 1uL deionized water.

[0038] The reaction mixture was placed on the reaction well of a real-time fluorescent 7500 PCR instrument (Applied Biosystems), and the PCR reaction was carried out according to the following procedures: 50°C for 2min, 95°C for 10min, entering a cycle of 95°C for 15s, 55°C for 33s, and 72...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pine wood nematode detecting reagent box which takes 5'ACC ATT CGG TTG GCT CTG TT 3' as a forward primer (F), takes a 5' CCC TAA GGC GTC GGT GAA C 3' as a reverse primer (R) and takes 5' FAM- TAG CTG AGC ATC TTT T-TAMRA 3' as a fluorescent probe (P). The invention also discloses a method for adopting the reagent box to detect the pine wood nematode. The primers and the probe in the pine wood nematode detecting reagent box of the invention have higher specificity, sensitivity as well as stability and provides a fast, sensitive and specific method for detecting the pine wood nematode.

Description

technical field [0001] The invention belongs to the field of plant protection and quality inspection, and relates to a pine wood nematode detection kit and a detection method thereof, in particular to a pine wood nematode real-time fluorescent PCR detection kit and a detection method thereof. Background technique [0002] Pine wood nematode [Bursaphelenchu ​​xylophilus (Sleiner&Buhrer) Nickle], also known as pine wilt disease, is spread by Monochamus alternatus Hope and mainly causes pine tree wilting, which can lead to pine tree death in a short period of time. a devastating disease. Hosts include dozens of pinus species including black pine (Pinus thunbergii), red pine (P.densiflosa) and masson pine (P.massoniana), and also harm a few non-pine conifers. The disease was first reported in Japan in 1905, and it has been distributed in many countries such as the United States, Canada, Mexico, Portugal, South Korea, Japan, and China, among which the most severe cases occurred ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68G01N21/64
Inventor 黄麟叶建仁吴小芹
Owner NANJING FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products