Construction and screen method of novel RNA interference vector

A technology of RNA interference and screening methods, which is applied in the direction of recombinant DNA technology and the use of vectors to introduce foreign genetic materials, etc. It can solve the problems of high experimental cost, cumbersome procedures, and heavy workload, so as to reduce the base error rate and improve experimental efficiency. , the effect of reducing the cost of experiments

Active Publication Date: 2009-04-29
HUBEI UNIV
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Method ②③ is not only time-consuming and cumbersome, but also has a high probability of non-target fragments or self-ligation on the carrier, which complicates the subsequent screening and identification process
[0006] 2. Not suitable for high-throughput operations
[0007] The fragments to be cloned in the above three methods all need to be purified in advance, and all rely on the ligation reaction between the carrier and the foreign fragments. This may be feasible for the construction of a single or a small number of RNA interference vectors, but for large-scale construction of RNA interference vectors but very difficult and inefficient
The oligonucleotide single strands used in methods ① and ② are usually 60-100nt. Synthesizing such oligonucleotide single strands not only has high experimental costs, but also has a high base synthesis error rate, which greatly increases the workload of subsequent screening. ,Time-consuming
The exogenous fragments in methods ② and ③ need to go through complicated steps such as double enzyme digestion, recovery and purification. Because the exogenous fragments are generally small (within 200bp), the efficiency of recovery and purification is low. These two methods are not only expensive , and the follow-up screening is difficult and the workload is heavy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and screen method of novel RNA interference vector
  • Construction and screen method of novel RNA interference vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] The invention is used to construct a plant artificial microRNA (amiRNA) expression vector which uses miR319a of Arabidopsis thaliana as the backbone and chalcone synthase (CHS) gene as the interference target gene.

[0039] 1) Transformation of the cloning vector

[0040] For the needs of subsequent experiments, the selected cloning vector is a donor plasmid that can be used in the mating-assisted genetically integrated cloning (MAGIC) method. After analysis, it was found that the plasmid DNA sequence carried two BfuI sites and one lacO sequence, the two BfuI sites were mutagenized into BamHI sites, and the lacO sequence was deleted and mutated. Insert the following fragments at the multiple cloning site of the transformed vector: "-promoter (P35S)-5' flanking sequence-BfuI site-gfp expression unit-BfuI site-lacO partial sequence-terminator (Tnos)- ", to obtain the transformation vector pDONOR-gfp. (See figure 2 )

[0041] 2) Formation of artificial microRNA-miR319...

Embodiment 2

[0051] The invention is used to construct an animal artificial microRNA (amiRNA) carrier with mammalian miR30 as the backbone and agtagattaccactggagtct as the interference target sequence.

[0052] 1) Transformation of the cloning vector

[0053] The vector pBluescript SK(+) sequence was analyzed, and the BfuI site and lacO sequence on the sequence were mutagenized. Insert the following fragments at the multiple cloning site of the transformed vector: "-promoter (CMV)-5' flanking sequence-BfuI site-gfp expression unit-BfuI site-lacO partial sequence-terminator (SV40PolyA)- ".

[0054] 2) Formation of artificial microRNA—mir30-X containing interference target sequence

[0055] According to the principles in step 2) of the specific method of the present invention, analyze the miR30 sequence, design and synthesize a universal primer pUR and a pair of specific primers pF & pR, mix the 3 primers, anneal at 25°C with Taq DNA polymerase, 72 °C extension, the obtained product is mi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a new method for constructing and screening an RNA interference vector. The method mainly comprises three parts: the vector is reconstructed; a DNA sequence containing an interference target sequence is generated; and the DNA sequence containing the interference target sequence is cloned to the vector. The method has fussy steps and low cloning efficiency and is suitable for high flux operation. The method does not need to order a primer with length of more than 60 nt, does not need to carry out complex enzyme cutting and purification treatment on a PCR product, but depends on the vector and foreign segments for connection and recombination instead, thereby producing a complete lacO sequence (lac operator); and in a lac<+> colibacillus strain, a recombinant is judged through screening blue-white spots. The screening method is convenient, intuitionistic, rapid and high efficient; and the obtained recombinant does not need directional identification, thereby easily realizing automation and high-flux operation.

Description

technical field [0001] The present invention relates to biological gene cloning and expression technology, in particular to a fast, efficient and high-throughput method for constructing animal and plant RNA interference (RNA interference, RNAi) vectors. It is especially suitable for large-scale construction of RNA interference units targeting various genes of animals and plants for functional research of genes of animals and plants, and the screening is convenient and quick. Background technique [0002] RNA interference refers to the specific degradation of homologous mRNA caused by double-stranded RNA in normal organisms, thereby inhibiting the process of corresponding gene expression. It is a type of post-transcriptional gene silencing that is ubiquitous in organisms. With the deepening of researchers' research on life phenomena, RNA interference technology has become an important technology in the fields of animal and plant gene function, gene therapy, drug target scree...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/66C12N15/82
Inventor马立新严红徐俊
OwnerHUBEI UNIV