Application of dominant negative mutant F427N as anthrax toxin inhibitor and vaccine

A technology of F427N and anthrax toxin, applied in the direction of microorganism-based methods, antibacterial drugs, microorganisms, etc., to achieve the effect of good immunogenicity and high biosafety

Inactive Publication Date: 2009-06-03
HUAZHONG AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The 427th amino acid of the PA gene is a key amino acid for PA activity, and its dominant inhibitory activity has been fully recognized, but these mutants have not been used in anthrax vaccine and toxin inhibition

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of dominant negative mutant F427N as anthrax toxin inhibitor and vaccine
  • Application of dominant negative mutant F427N as anthrax toxin inhibitor and vaccine
  • Application of dominant negative mutant F427N as anthrax toxin inhibitor and vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Cloning of the target gene

[0039] (1) Cloning of Bacillus anthracis protective antigen PA gene

[0040] 1. PCR primer design and synthesis

[0041] The upstream and downstream primers were designed according to the PA gene sequence reported in Genbank (Genbank accession number: No.AF065404). The upstream primer introduces the BamHI restriction site (as indicated by the underline in the primer), and designs 4 protective bases ACTA, and the downstream primer introduces the XhoI restriction site (as indicated by the underline in the primer), plus 4 protective bases GTAT. The primers of the present invention were synthesized by Shanghai Sangon Bioengineering Technology Co., Ltd. The sequence of the primer pair is as follows:

[0042] PA upstream primer: 5'-ACTA GGATCC GAAGTTAAACAGGAGAACC-3'

[0043] PA downstream primer: 5'-GTAT CTCGAG CTATTATCCTATCTCATAGCCT-3'

[0044] 2. PA protein coding gene amplification and processing

[0045] Acapsulated anthra...

Embodiment 2

[0058] Example 2 Site-directed saturation mutation of the 427th amino acid of the protective antigen PA and cloning of the mutant

[0059] 1. Site-directed saturation mutation of phenylalanine at position 427 of the Bacillus anthracis protective antigen PA gene into 19 other naturally occurring amino acids

[0060] (1) PCR primer design and synthesis

[0061]According to the PA gene sequence in Genbank (Genbank accession number: No.AF065404), the upstream and downstream primers for site-directed saturation mutation of amino acid 427 of PA were designed. In the upstream and downstream primers, the codon TTC of phenylalanine was designed as a randomly synthesized base NNN (as indicated by the underline in the primer). The primers of the present invention were synthesized by Shanghai Sangon Bioengineering Technology Co., Ltd. F427N upstream primer: 5`-CGCATTAAATGCACAAGACGAT NNN AGTTCTACTCC-3`; (N = A, T, G, C)

[0062] F427N downstream primer: 5`CATTGTAATTGGAGTAGAACT NNN A...

Embodiment 4

[0089] Example 4 The activity of inhibiting anthrax toxin of PA mutant F427X

[0090] (1) In vitro inhibition of anthrax toxin activity

[0091] 1. Culture of mouse macrophage RAW264.7

[0092] Mouse macrophage RAW264.7 (Cell Bank of Type Culture Collection Committee, Chinese Academy of Sciences) was placed in DMEM containing 10% newborn bovine serum (purchased from Hangzhou Sijiqing Bioengineering Materials Co., Ltd.) at 37°C, 5% CO 2 cultured in an incubator.

[0093] 2. Cytotoxicity experiment

[0094] The combination of PA and LF is called lethal toxin (LT), which can lead to the death of sensitive cells (such as mouse macrophage RAW264.7) in vitro. 16 hours before the experiment, the mouse macrophage RAW264.7 was mixed with 3×10 4 Cells / well were inoculated in 96-well culture plates, and when the cells grew to 90% full, the culture medium in the 96-well plates was discarded, and fresh medium containing 1 μg / mL LF and concentrations of 20, 10, 5, 2.5, 1.25, 0.625, 0.3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of animal bacteriology and anthropozoonosis science, in particular to the application of dominant negative mutant F427N as bacillus anthracis toxin inhibitor and vaccine. In the invention, by the methods of bacillus anthracis lethal toxin gene clone, protein expression and purification, gene fixed point saturation mutation and the like, the protective antigen protein of the bacillus anthracis (namely, dominant negative mutant F427N) is obtained. The mutant is successfully cloned to bacterial expression vector pGEX-KG, thus forming recombinant plasmid pGEX-KG-PA (F427N). The colon bacillus containing the recombinant plasmid is named as Escherichia coli DH5 alpha / pGEX-KG-PA (F427N) and preserved at China Center for Type Culture Collection. The preservation code is CCTCC-M208159. The invention also discloses a method for preparing the antigen protein, a method for preparing the anthrax toxin inhibitor and subunit vaccine with the antigen protein and the application thereof.

Description

technical field [0001] The invention relates to the technical fields of animal bacteriology and zoonotic infectious diseases. It specifically relates to the application of a dominant suppressing mutant F427N as an anthracis bacillus toxin inhibitor and a subunit vaccine. Background technique [0002] Anthrax is an acute, febrile, septic infectious disease caused by Bacillus anthracis. Characterized by sudden hyperthermia and death, cyanosis of visible mucosa, and coal tar-like blood from natural orifices. The OIE lists it as a Category B disease and a nationally notifiable disease. Bacillus anthracis is a long, thick, large bacterium of the aerobic Bacillus genus, without flagella, immobile, and Gram-positive. There are two forms of propagules and spores, and anthrax spores with strong resistance can be formed under sufficient oxygen and appropriate temperature. Because anthrax is easy to produce and prepare, its spore state can exist stably for a long time, it has stron...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C07K14/195A61K39/02A61P31/04C12R1/19
Inventor郭爱珍曹莎陈焕春刘子铎张承才谭亚娣
OwnerHUAZHONG AGRI UNIV