Application of dominant negative mutant F427N as anthrax toxin inhibitor and vaccine
A technology of F427N and anthrax toxin, applied in the direction of microorganism-based methods, antibacterial drugs, microorganisms, etc., to achieve the effect of good immunogenicity and high biosafety
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Cloning of the target gene
[0039] (1) Cloning of Bacillus anthracis protective antigen PA gene
[0040] 1. PCR primer design and synthesis
[0041] The upstream and downstream primers were designed according to the PA gene sequence reported in Genbank (Genbank accession number: No.AF065404). The upstream primer introduces the BamHI restriction site (as indicated by the underline in the primer), and designs 4 protective bases ACTA, and the downstream primer introduces the XhoI restriction site (as indicated by the underline in the primer), plus 4 protective bases GTAT. The primers of the present invention were synthesized by Shanghai Sangon Bioengineering Technology Co., Ltd. The sequence of the primer pair is as follows:
[0042] PA upstream primer: 5'-ACTA GGATCC GAAGTTAAACAGGAGAACC-3'
[0043] PA downstream primer: 5'-GTAT CTCGAG CTATTATCCTATCTCATAGCCT-3'
[0044] 2. PA protein coding gene amplification and processing
[0045] Acapsulated anthra...
Embodiment 2
[0058] Example 2 Site-directed saturation mutation of the 427th amino acid of the protective antigen PA and cloning of the mutant
[0059] 1. Site-directed saturation mutation of phenylalanine at position 427 of the Bacillus anthracis protective antigen PA gene into 19 other naturally occurring amino acids
[0060] (1) PCR primer design and synthesis
[0061]According to the PA gene sequence in Genbank (Genbank accession number: No.AF065404), the upstream and downstream primers for site-directed saturation mutation of amino acid 427 of PA were designed. In the upstream and downstream primers, the codon TTC of phenylalanine was designed as a randomly synthesized base NNN (as indicated by the underline in the primer). The primers of the present invention were synthesized by Shanghai Sangon Bioengineering Technology Co., Ltd. F427N upstream primer: 5`-CGCATTAAATGCACAAGACGAT NNN AGTTCTACTCC-3`; (N = A, T, G, C)
[0062] F427N downstream primer: 5`CATTGTAATTGGAGTAGAACT NNN A...
Embodiment 4
[0089] Example 4 The activity of inhibiting anthrax toxin of PA mutant F427X
[0090] (1) In vitro inhibition of anthrax toxin activity
[0091] 1. Culture of mouse macrophage RAW264.7
[0092] Mouse macrophage RAW264.7 (Cell Bank of Type Culture Collection Committee, Chinese Academy of Sciences) was placed in DMEM containing 10% newborn bovine serum (purchased from Hangzhou Sijiqing Bioengineering Materials Co., Ltd.) at 37°C, 5% CO 2 cultured in an incubator.
[0093] 2. Cytotoxicity experiment
[0094] The combination of PA and LF is called lethal toxin (LT), which can lead to the death of sensitive cells (such as mouse macrophage RAW264.7) in vitro. 16 hours before the experiment, the mouse macrophage RAW264.7 was mixed with 3×10 4 Cells / well were inoculated in 96-well culture plates, and when the cells grew to 90% full, the culture medium in the 96-well plates was discarded, and fresh medium containing 1 μg / mL LF and concentrations of 20, 10, 5, 2.5, 1.25, 0.625, 0.3...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com