Novel disinsection Bt protein Cry54Aa1, coding gene thereof and use
A bt protein, gene technology, applied in applications, pesticides, genetic engineering, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1 Cloning of cry54Aa1 gene
[0026] The present invention is a new bacterial strain of Bacillus thuringiensis (Bacillus thuringiensis) isolated from the soil in the virgin forest area of Muchuan, Sichuan Province. No. 3, Datun Road, Chaoyang District, City, Institute of Microbiology, Chinese Academy of Sciences, Zip Code 100101) is preserved, and the classification is named Bacillus thuringiensis (Bacillus thuringiensis), and the preservation number is CGMCC No.2719.
[0027] In this example, the full-length sequence of the cry54Aa1 gene was cloned by the following method.
[0028] The total DNA of strain BtMC28 was extracted using a genomic DNA purification kit (purchased from Saibaisheng Company). The primer sequences were designed as follows:
[0029] P1: 5'ATGAGTATGAAATCATTGATTC3'
[0030] P2: 5'CACGTCAGGGGTAAATTCGATT3'
[0031] PCR reaction system:
[0032]10×buffer 2.5μl
[0033] MgCl 2 (25mM) 1.5μl
[0034] Taq enzyme 0.2μl
[0035] dNTPs (2.5m...
Embodiment 2
[0040] Example 2 Expression of cry54Aa1 gene and determination of insecticidal activity
[0041] According to the sequence at both ends of the open reading frame of the cry54Aa1 gene, a pair of specific primers cry54A: 5′-GCG was designed and synthesized CATATG (NdeI)ATGAGTATGAAATCATTGATTC-3'; cry30R: 5'-CG GAATTC (EcoR I) CACGTCAGGGGTAAATTCGATT-3', respectively at the 5' end primers Nde I and EcoR I restriction sites. The total DNA of BtMC28 was used as a template to amplify, and the amplified product was double digested with Nde I and EcoR I, and the digested product was ligated with the vector pET-30a(+) after the same double digestion, and transformed into E.coliDH5α sensory state cells, extract their plasmids and electrophoresis to verify that the size of the inserted fragment meets the expected purpose ( figure 2 ), and then transferred into the recipient strain E.coli.BL21(DE3). The recombinant plasmid was named pET-54Aa, and the recombinant containing the recombi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
