Engineering bacterial strain containing integron
A technology of engineering strains and integrons, which is applied in the field of engineering strains containing integrons, can solve the problems of ambiguity, the burden of host bacteria reproduction, etc., and achieve the effect of easy transformation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] 1. Use PCR to amplify the integron gene: the primers used in the amplification process are, INTBH 5′GCGGGATCCTTACTACCTTCACTAGTGAGGGGCG 3′, ORFPF 5′GCGCTG CAGCTGCGCAGCCCATGCAGGCGA 3′, the amplification system of the integron gene is: deionized water 68μl, 10×LAbuffer 10 μl, dNTP 16 μl, primers INTBH and ORFPF 2 μl each, LA Taq DNA polymerase 1 μl (TaKaRa), strain No. 148 genomic DNA 1 μl (the sequence of the integron contained in this strain is the same as the sequence of the integron on the pCTX-M3 plasmid The same, GenBank accession number: AF550415.2), the amplification conditions are 95°C pre-denaturation for 5 minutes, 95°C for 1 minute, 55°C for 1 minute, 72°C for 1 minute, a total of 30 cycles, and finally 72°C for 7 minutes.
[0026] 2. Cloning the integron gene into the transposon construction vector: take 50 μl of the PCR amplification product of the integron gene and purify it with DNA purification reagent (TaKaRa) according to the instructions, and finally elu...
Embodiment 2
[0034] Application of DHS engineering bacteria to capture the aadA2 drug resistance gene cassette on the pACDA plasmid:
[0035] 1. Routinely cultivate the DHS bacterial strain with LB liquid medium, and make it into competent cells according to standard methods;
[0036] 2. Transform the above-mentioned competent cells with the plasmid pACDA containing the aadA2 drug resistance gene cassette, spread the LB agar plate containing chloramphenicol, and after culturing overnight at 37°C, select positive clones to make competent cells according to standard methods;
[0037] 3. Transform the above-mentioned competent cells with the plasmid pUCINT that highly expresses integrase, smear the LB agar plate containing ampicillin, culture overnight at 37°C, select positive clones and inoculate 5ml of LB liquid medium containing chloramphenicol and ampicillin, 37 Cultivate overnight at ℃;
[0038] 4. Take 1ml of DHS bacterial solution containing pACDA and pUCINT plasmids cultivated overni...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 