Unlock instant, AI-driven research and patent intelligence for your innovation.

Engineering bacterial strain containing integron

A technology of engineering strains and integrons, which is applied in the field of engineering strains containing integrons, can solve the problems of ambiguity, the burden of host bacteria reproduction, etc., and achieve the effect of easy transformation

Inactive Publication Date: 2009-08-12
AFFILIATED HUSN HOSPITAL OF FUDAN UNIV
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Integrons gain a survival advantage by capturing favorable gene cassettes, such as drug resistance gene cassettes, in some cases, but they may also capture some gene cassettes that are toxic to the host and cause adverse effects, or over-capture gene cassettes and cause a certain burden on the reproduction of host bacteria
Therefore, in the process of capturing foreign gene cassettes, bacterial integrons must have a complete and fine regulatory mechanism, but this mechanism is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacterial strain containing integron
  • Engineering bacterial strain containing integron
  • Engineering bacterial strain containing integron

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] 1. Use PCR to amplify the integron gene: the primers used in the amplification process are, INTBH 5′GCGGGATCCTTACTACCTTCACTAGTGAGGGGCG 3′, ORFPF 5′GCGCTG CAGCTGCGCAGCCCATGCAGGCGA 3′, the amplification system of the integron gene is: deionized water 68μl, 10×LAbuffer 10 μl, dNTP 16 μl, primers INTBH and ORFPF 2 μl each, LA Taq DNA polymerase 1 μl (TaKaRa), strain No. 148 genomic DNA 1 μl (the sequence of the integron contained in this strain is the same as the sequence of the integron on the pCTX-M3 plasmid The same, GenBank accession number: AF550415.2), the amplification conditions are 95°C pre-denaturation for 5 minutes, 95°C for 1 minute, 55°C for 1 minute, 72°C for 1 minute, a total of 30 cycles, and finally 72°C for 7 minutes.

[0026] 2. Cloning the integron gene into the transposon construction vector: take 50 μl of the PCR amplification product of the integron gene and purify it with DNA purification reagent (TaKaRa) according to the instructions, and finally elu...

Embodiment 2

[0034] Application of DHS engineering bacteria to capture the aadA2 drug resistance gene cassette on the pACDA plasmid:

[0035] 1. Routinely cultivate the DHS bacterial strain with LB liquid medium, and make it into competent cells according to standard methods;

[0036] 2. Transform the above-mentioned competent cells with the plasmid pACDA containing the aadA2 drug resistance gene cassette, spread the LB agar plate containing chloramphenicol, and after culturing overnight at 37°C, select positive clones to make competent cells according to standard methods;

[0037] 3. Transform the above-mentioned competent cells with the plasmid pUCINT that highly expresses integrase, smear the LB agar plate containing ampicillin, culture overnight at 37°C, select positive clones and inoculate 5ml of LB liquid medium containing chloramphenicol and ampicillin, 37 Cultivate overnight at ℃;

[0038] 4. Take 1ml of DHS bacterial solution containing pACDA and pUCINT plasmids cultivated overni...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of microorganism animal cell line, and in particular relates to an engineering strain containing an integron. The engineering strain is eschrichia.coli, with a preservation number of C6MCC No.2353. The strain is named DHS, and the chromosome DNA of the strain has a structure of a sequence 1. In the invention, a transposon is used as a tool to insert an integron having a known sequence into the chromosome DNA of a colon bacillus. Tests show that the strain can capture an addA2 drug-resistance gene cassette in the presence of a high-expression integrase. The establishment of the strain lays a foundation for deeply researching a mechanism for the integron to capture the drug-resistance gene cassette in strains with known genetic background, and the strain can be used as a tool strain in other researches about the integron.

Description

technical field [0001] The invention belongs to the field of microbial animal cell lines, and in particular relates to an engineering strain containing an integron. Background technique [0002] According to reports, in the current clinical treatment, the drug resistance of bacteria is very serious, especially the emergence of multi-drug resistant strains is a huge challenge to the treatment of clinical bacterial infectious diseases. It is expected that gene mutations may lead to the emergence of strains resistant to a single antibiotic, but it is difficult to explain the resistance to multiple antibiotics in the same strain. Studies have shown that the horizontal transmission of genetic material within and between strains is an important way for bacteria to acquire new drug resistance. The importance of these mechanisms is illustrated by the rapid and widespread spread of resistance and the emergence of very similar resistance patterns across different bacterial species. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/11C12N15/70C12R1/19
Inventor 吕元杨泽华蒋晓飞张弢刘维薇
Owner AFFILIATED HUSN HOSPITAL OF FUDAN UNIV