Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Procambarus clarki astacidin antibacterial peptide gene, coded antibacterial peptide thereof and use

A technology for describing Crayfish Apexidine and Crayfish Crayfish is applied in the field of genetic engineering, and can solve the problem that there is no Apexidine antibacterial peptide gene, and no Crayfish Apexidine antimicrobial peptide gene is found. Issues such as recombinant expression and functional studies

Inactive Publication Date: 2009-08-12
SHANDONG UNIV
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the related reports, there is no report of the aptidexidin antimicrobial peptide gene of Crayfish clarkii
Although similar genes have been found in crayfish (P.leniusculus) abroad, so far there are no reports on the gene and its recombinant expression and function of Procambarus clarkii at home and abroad.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Procambarus clarki astacidin antibacterial peptide gene, coded antibacterial peptide thereof and use
  • Procambarus clarki astacidin antibacterial peptide gene, coded antibacterial peptide thereof and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Embodiment 1: the cloning of cDNA of Procrayfish clarkii (astacidin) antibacterial peptide cDNA

[0070] 1) Extraction of total RNA: Total RNA was extracted by one-step method using the prior art.

[0071] 2) cDNA first-strand synthesis: 4 microliters of total RNA, plus 1 microliter of SmartF and 1 microliter of OligoanchorR, reacted at 72°C for 5 minutes, then added 4 microliters of 5-fold Buffer, 1.25 microliters of dNTP, and 0.625 RNase inhibitor Microliter, 1 microliter of MMLV reverse transcriptase, 12.875 microliters of RNase-free sterilized water, react at 42°C for 60 minutes, and stop the reaction at 70°C for 10 minutes.

[0072] 3) PCR reaction: chain polymerase reaction (PCR) reagents and conditions:

[0073] First mix the following reagents together:

[0074] 10xTaq DNA polymerase buffer 5 microliters (μl)

[0075] ·Template cDNA 1μl

[0076] ·Forward primer (10mM) 1μl

[0077] ·Reverse primer (10mM) 1μl

[0078] ·Deoxyribonucleotide mixture (dNTP) 4μl ...

Embodiment 2

[0097] Example 2: Construction, expression and antibacterial function determination of atacidin (astacidin) recombinant expression vector

[0098] (1) According to the cloning site of the sequence of the crayfish crayfish acitidine antimicrobial peptide and the expression vector pGEX4T-1 (Novagen Company), design primers:

[0099] ExF: TACTCA GAATT CTCCAATGGTTACCGTCCCG (the underline is the EcoR I site)

[0100] ExR: TACTCA CTCGAG TTACTTGCCTGGACGGTA (XhoI site is underlined)

[0101] The present invention selects the EcoR I and Xho I restriction sites of the pGEX4T-1 cloning site. Therefore, when designing the primers, the EcoR I restriction site is introduced into the upstream primer, and the Xho I restriction site is introduced into the downstream primer.

[0102] (2) Gene amplification, cloning and recombinant plasmid screening

[0103] Using pMD-18T-Aptidexidin as a template, carry out PCR reaction with the above primers, the amplification conditions are: 94°C, 2min ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Procambarus clarkii astacidin antibacterial peptide gene and coded antibacterial peptide thereof, and also discloses application of the Procambarus clarkii astacidin antibacterial peptide gene in preparing recombinant protein with antibacterial activity. The antibacterial peptide of recombinant Procambarus clarkii astacidin obtained through gene expression can be used in antibacterial feed additives, food preservation, animal-plant gene transformation, drug development and other fields.

Description

technical field [0001] The present invention relates to an antimicrobial peptide gene and its coded antibacterial polypeptide and its application, in particular to an antibacterial peptide gene of Protocrayus clarkii and its coded antibacterial polypeptide. The application of gene in the preparation of recombinant protein with antibacterial activity belongs to the technical field of genetic engineering. Background technique [0002] Procambarus clarkii, commonly known as freshwater crayfish, is an important aquaculture species in my country. Crayfish is delicious, with high content of phosphorus, calcium, iron and other elements, high protein content, and low fat content. It is an economical aquaculture species with high nutritional value. Moreover, the extract of the shrimp shell of crayfish has a wide application value in industry, agriculture, medicine and chemical industry. Therefore, research on disease prevention and treatment of crayfish is particularly important. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N15/70C12N15/81C12N15/866C07K14/435
Inventor 王金星赵小凡
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com