Procambarus clarki astacidin antibacterial peptide gene, coded antibacterial peptide thereof and use
A technology for describing Crayfish Apexidine and Crayfish Crayfish is applied in the field of genetic engineering, and can solve the problem that there is no Apexidine antibacterial peptide gene, and no Crayfish Apexidine antimicrobial peptide gene is found. Issues such as recombinant expression and functional studies
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0069] Embodiment 1: the cloning of cDNA of Procrayfish clarkii (astacidin) antibacterial peptide cDNA
[0070] 1) Extraction of total RNA: Total RNA was extracted by one-step method using the prior art.
[0071] 2) cDNA first-strand synthesis: 4 microliters of total RNA, plus 1 microliter of SmartF and 1 microliter of OligoanchorR, reacted at 72°C for 5 minutes, then added 4 microliters of 5-fold Buffer, 1.25 microliters of dNTP, and 0.625 RNase inhibitor Microliter, 1 microliter of MMLV reverse transcriptase, 12.875 microliters of RNase-free sterilized water, react at 42°C for 60 minutes, and stop the reaction at 70°C for 10 minutes.
[0072] 3) PCR reaction: chain polymerase reaction (PCR) reagents and conditions:
[0073] First mix the following reagents together:
[0074] 10xTaq DNA polymerase buffer 5 microliters (μl)
[0075] ·Template cDNA 1μl
[0076] ·Forward primer (10mM) 1μl
[0077] ·Reverse primer (10mM) 1μl
[0078] ·Deoxyribonucleotide mixture (dNTP) 4μl ...
Embodiment 2
[0097] Example 2: Construction, expression and antibacterial function determination of atacidin (astacidin) recombinant expression vector
[0098] (1) According to the cloning site of the sequence of the crayfish crayfish acitidine antimicrobial peptide and the expression vector pGEX4T-1 (Novagen Company), design primers:
[0099] ExF: TACTCA GAATT CTCCAATGGTTACCGTCCCG (the underline is the EcoR I site)
[0100] ExR: TACTCA CTCGAG TTACTTGCCTGGACGGTA (XhoI site is underlined)
[0101] The present invention selects the EcoR I and Xho I restriction sites of the pGEX4T-1 cloning site. Therefore, when designing the primers, the EcoR I restriction site is introduced into the upstream primer, and the Xho I restriction site is introduced into the downstream primer.
[0102] (2) Gene amplification, cloning and recombinant plasmid screening
[0103] Using pMD-18T-Aptidexidin as a template, carry out PCR reaction with the above primers, the amplification conditions are: 94°C, 2min ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com