Method for restructuring/breeding Actinobacillus succinogenes strain, and method for producing succinic acid by fermenting Actinobacillus succinogenes strain

A technology of actinobacillus and succinic acid, applied in the field of bioengineering, can solve the problems of long screening time, low forward mutation rate, and large screening volume

Inactive Publication Date: 2009-09-16
JIANGNAN UNIV
View PDF0 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The environmental tolerance of microorganisms, such as the genetic coding mechanism of phenotypes such as acid resistance and heat resistance, is not yet fully understood. It is difficult to modify the traits controlled by multiple genes scattered on the genome by direct genetic engineering technology; However, the forward mutation rate of traditional mutagenesis is very low, and the amount of screening required to improve a strain is large and the screening time is long

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] The starting bacteria Actinobacillus succinogenes CGMCC1593 was cultured with seeds for 5 hours, and made into a bacterial suspension, which was subjected to X-ray mutagenesis, ultraviolet mutagenesis, EMS chemical mutagenesis and NTG mutagenesis, respectively, and carried out preliminary screening on the plate. Anaerobic bottle fermentation and re-screening, each obtained a high-yielding strain X-8, UV-17, SE-6 and SF-9, which were used as the parental strains of genome shuffling. Table 1 shows the results of the fermentation of succinic acid by each mutant strain and the starting bacteria in the anaerobic bottle.

[0041] Table 1. Results of succinic acid production by fermentation of mutant strains in anaerobic bottles

[0042] Strain number CGMCC1593 X-8 UV-17 SE-6 SF-9 Type of mutagen x-ray ultraviolet light EMS NTG screening plate NaCl NaCl NaCl Sodium fluoroacetate Succinic acid production (g / L) 28.9 30.1 30...

Embodiment 2

[0044] Using the mutant strains X-8, UV-17, SE-6 and SF-9 as the parent strains, three rounds of protoplast fusion were carried out, and the positive mutant strains in each round of shuffling were combined with the starting strain CGMCC1593 and the shuffled parent strain X-8 , UV-17, SE-6 and SF-9 were fermented to produce succinic acid in the fermentation medium without NaCl and in the anaerobic fermentation medium containing 0.2mol / L NaCl respectively.

[0045] After three rounds of recombination, when the strain F3 was fermented in the anaerobic bottle fermentation medium without NaCl, the succinic acid production increased by about 36.0% compared with the original strain CGMCC1593, and when it was fermented in the medium containing 0.2mol / L NaCl, the F3 generation The succinic acid production of the four mutant strains was about 70.0% higher than that of the original strain CGMCC1593. Since the present invention aims at screening the bacterial strains with good tolerance t...

Embodiment 3

[0048] For the strain of the mutant strain F3-10, the chromosomal DNA was extracted according to the method of the refined molecular biology experiment guide, and Y1 and Y2 were used as forward and reverse primers (Y1: ATTGAACGCTGGCGGCAGGC, Y2: CGGGCGGTGTGTACAAGGCC), and PCR was used to amplify 16S For the rRNA gene, Shanghai Sangon Bioengineering Technology Service Co., Ltd. was commissioned to perform 16S rDNA sequencing (see the chart below for the results). By comparison with the 16S rDNA gene sequence (Genbank) of the starting strain CGMCC1593, it was found that the 16S rDNA gene sequence of the genome shuffling mutant F3-10 and the starting strain CGMCC1593 had almost no changes, only two point mutations at 393bp and 1200bp (represented by a box), respectively G→A, C→T.

[0049] The following is the 1289bp fragment of the 16S rDNA sequence of the mutant strain F3-10.

[0050] 1 CGGTAACGGG TGGAAAGCTT GCTTTCCATG CTGACGAGTG GCGGACGGGT GAGTAATGCT

[0051] 61 TGGGGATCTG GCT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an Actinobacillus succinogenes strain CGMCC 2653 (namely F3-10) with better sodium-ion tolerance and acid-producing performance, a method for breeding the strain and a method for producing succinic acid by fermenting the strain. Actinobacillus succinogenes CGMCC 1593 is taken as an original strain and then subjected to X-ray mutation, ultraviolet mutation, diethyl sulfate (EMS) chemical mutation and nitrosoguanidine (NTG) chemical mutation respectively; three strains X-8, UV-17 and SE-6 with improved fermentative acid-producing performance and particularly improved sodium-ion tolerance, as well as a high-yield strain SF-9 with fluoroacetate resistance, are obtained by screening the obtained product; and a genome restructuring method is used for breeding the strains so as to obtain the strain F3-10 with high yield, sodium tolerance and fluoroacetate resistance. The strain F3-10 takes sugarcane molasses as raw material, adopts Na2CO3 to control fermentation pH, and performs fed-batch fermentation in a 5L fermenter, and produces 53.96 grams of succinic acid per liter in 48 hours; the yield of consumed sugar is 89.2 percent; the utilization rate of sugar is 94.0 percent; and the ratio of succinic acid to heteroacid is 6.58:1. Therefore, the strain F3-10 is remarkably improved as compared with the original strain CGMCC 1593.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a strain of Actinobacillus succinogenes CGMCC 2653 (namely F3-10) with strong sodium ion tolerance and acid production performance, the breeding method of the strain and the strain The method is applied to the method of producing succinic acid by anaerobic fermentation. Background technique [0002] Succinic acid, also known as succinic acid, has the molecular formula C 4 h 6 o 4 , with a molecular weight of 118.09, is a common natural organic acid that widely exists in the human body, animals, plants and microorganisms. Succinic acid is an important four-carbon compound in industry. It is widely used in food, medicine, pesticides, dyes, spices, paints, plastics and material industries as organic synthesis raw materials, intermediate products, and professional chemicals. At present, the production of succinic acid and most of its derivatives is still in the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/20C12N15/01C12N15/03C12P7/46C12R1/01
Inventor孙志浩倪晔郑璞董晋军
OwnerJIANGNAN UNIV