Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Antibody of fucosylated Golgi protein GP73 and use thereof

A technology of fucosylation and glycosylation, which is applied in the field of biomedicine, can solve problems such as complex operation, and achieve the effect of low detection cost and fast detection method

Inactive Publication Date: 2009-10-14
THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
View PDF2 Cites 31 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] Chinese patent application document CN 101062939A, titled "Device and kit for detecting fucosylated Golgi protein GP73 in liver cancer", discloses a device and kit for detecting fucosylated Golgi protein GP73 in liver cancer The method, the antibody is a general anti-GP73 antibody, not a specific antibody for glycosylated proteins. The method needs to first isolate all glycosylated proteins, and then use antibodies to detect GP73, which is complicated to operate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antibody of fucosylated Golgi protein GP73 and use thereof
  • Antibody of fucosylated Golgi protein GP73 and use thereof
  • Antibody of fucosylated Golgi protein GP73 and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1, construction of pRevHyg-GP73 vector:

[0069] Design GP73 primers:

[0070] 5′ tatggatccatgatggggcttgggaaacg3′ and

[0071] 5' aggatcgattcagagtgtatgattccgcttttc3';

[0072] Human GP73 cDNA was amplified by PCR technology, and the restriction sites were ClaI and NotI (purchased from Openbiosystems, USA). Use PFU DNA polymerase (purchased from Stratagene, the U.S.) to carry out PCR reaction (95 degrees Celsius for 1 minute, 52 degrees Celsius for 1 minute, 72 degrees Celsius for 1.2 minutes, a total of 30 cycles), the size of the amplified fragment is 1.2kb ( Figure 8 ). The PCR product and the pRevHyg plasmid (recorded in Cancer Res.2004, 64:3436-43) were digested with ClaI and NotI (purchased from Treasure Bioengineering (Dalian) Co., Ltd.), electrophoresed on 1% agarose gel and cut into gel After recovery, T4 DNA ligase (purchased from Treasure Bioengineering (Dalian) Co., Ltd.) was used for ligation, and the ligation reaction mixture was transformed ...

Embodiment 2

[0073] Embodiment 2, cell culture:

[0074] HepG2 cell line (ADCC, USA) was cultured in CO with DMEM medium containing 10% fetal bovine serum (FBS) (purchased from Beijing Nuyin Applied Technology Development Co., Ltd.) 2 Incubator (37 degrees, 5% CO 2 ), while using the pRevHyg-GP73 plasmid constructed in Example 1 to transfect the virus packaging cell PT67 (purchased from Clontech, the United States), and the transfected cells were selected by using 50ug / ml hygromycin (Hygromycin, purchased from Sigma, the United States). The PT67 cells that have been transfected with pRevHyg-GP73, and produce pRevHyg-GP73 virus, are infected with HepG2 cells and use 50ug / ml hygromycin (purchased from Sigma, the U.S.) to screen out the HepG2 cells (HepG2-GP73) infected with pRevHyg-GP73 virus. ).

Embodiment 3

[0075] Embodiment 3, Western-blot detects the expression of GP73 in HepG2 cell culture medium:

[0076] Collect the DMEM culture fluid of the HepG2-GP73 cells obtained in Example 2 (purchased from Beijing Niuyin Applied Technology Development Co., Ltd.), add double the amount of protein denaturation solution ([60mM Tris-HCl (pH 6.8), 2% SDS, 10% glycerol and 100mM DTT), denatured by heating at 95 degrees Celsius, and subjected to 4-12% SDS-PAGE electrophoresis. Proteins were transferred to polyvinylidene fluoride membrane (PVDF membrane) by semi-dry transfer method. The membrane was blocked with 5% BSA (Sigma, USA) at room temperature for 1 hour, then incubated overnight at 4 degrees with 1:1000 diluted GP73 antibody (purchased from SCBT, USA) and 1:2000 diluted horseradish peroxidase (HRP )-labeled goat anti-mouse IgG was incubated at room temperature for 1 hour, and chemiluminescence (ECL) detection was carried out in a dark room. The results showed that infected HepG2 co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an antibody against fucosylated protein GP73, a method for preparing the antibody against the fucosylated protein GP73, a reagent for diagnosing liver cancers, a kit for diagnosing the liver cancers, application of the reagent and / or the kit to preparing products for diagnosing liver diseases and a method for preparing purified fucosylated protein GP73. Occurrence, development and metastasis of liver cancers are diagnosed by detecting the fucosylated protein GP73 or the antibody. The antibody against the fucosylated protein GP73 can be more widely used for affinity chromatography, cDNA library screening, immunologic diagnosis or pharmaceutical preparation.

Description

technical field [0001] The invention belongs to the field of biomedicine. Specifically, the present invention relates to an antibody against fucosylated GP73 protein, a method for preparing the antibody against fucosylated GP73 protein, a reagent for diagnosing liver cancer, A kit for diagnosing liver cancer, providing the above-mentioned reagent and / or the application of the kit in preparing products for diagnosing liver diseases, and a method for preparing and purifying fucosylated GP73 protein. Background technique [0002] my country is a big country with hepatitis B, and the cirrhosis and hepatocellular carcinoma caused by the development of hepatitis B have brought a great burden to my country's medical resources. According to recent statistics, every two new cases of liver cancer patients in the world are One case occurred in China. Early diagnosis and treatment of liver cancer is an important task facing the field of liver science in our country. [0003] In the 19...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/14C07K14/405C12N15/31C12N15/85C12N5/18G01N33/577
Inventor 张宏冰毛一雷
Owner THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products