Antibody of fucosylated Golgi protein GP73 and use thereof
A technology of fucosylation and glycosylation, which is applied in the field of biomedicine, can solve problems such as complex operation, and achieve the effect of low detection cost and fast detection method
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Example 1, construction of pRevHyg-GP73 vector:
[0069] Design GP73 primers:
[0070] 5′ tatggatccatgatggggcttgggaaacg3′ and
[0071] 5' aggatcgattcagagtgtatgattccgcttttc3';
[0072] Human GP73 cDNA was amplified by PCR technology, and the restriction sites were ClaI and NotI (purchased from Openbiosystems, USA). Use PFU DNA polymerase (purchased from Stratagene, the U.S.) to carry out PCR reaction (95 degrees Celsius for 1 minute, 52 degrees Celsius for 1 minute, 72 degrees Celsius for 1.2 minutes, a total of 30 cycles), the size of the amplified fragment is 1.2kb ( Figure 8 ). The PCR product and the pRevHyg plasmid (recorded in Cancer Res.2004, 64:3436-43) were digested with ClaI and NotI (purchased from Treasure Bioengineering (Dalian) Co., Ltd.), electrophoresed on 1% agarose gel and cut into gel After recovery, T4 DNA ligase (purchased from Treasure Bioengineering (Dalian) Co., Ltd.) was used for ligation, and the ligation reaction mixture was transformed ...
Embodiment 2
[0073] Embodiment 2, cell culture:
[0074] HepG2 cell line (ADCC, USA) was cultured in CO with DMEM medium containing 10% fetal bovine serum (FBS) (purchased from Beijing Nuyin Applied Technology Development Co., Ltd.) 2 Incubator (37 degrees, 5% CO 2 ), while using the pRevHyg-GP73 plasmid constructed in Example 1 to transfect the virus packaging cell PT67 (purchased from Clontech, the United States), and the transfected cells were selected by using 50ug / ml hygromycin (Hygromycin, purchased from Sigma, the United States). The PT67 cells that have been transfected with pRevHyg-GP73, and produce pRevHyg-GP73 virus, are infected with HepG2 cells and use 50ug / ml hygromycin (purchased from Sigma, the U.S.) to screen out the HepG2 cells (HepG2-GP73) infected with pRevHyg-GP73 virus. ).
Embodiment 3
[0075] Embodiment 3, Western-blot detects the expression of GP73 in HepG2 cell culture medium:
[0076] Collect the DMEM culture fluid of the HepG2-GP73 cells obtained in Example 2 (purchased from Beijing Niuyin Applied Technology Development Co., Ltd.), add double the amount of protein denaturation solution ([60mM Tris-HCl (pH 6.8), 2% SDS, 10% glycerol and 100mM DTT), denatured by heating at 95 degrees Celsius, and subjected to 4-12% SDS-PAGE electrophoresis. Proteins were transferred to polyvinylidene fluoride membrane (PVDF membrane) by semi-dry transfer method. The membrane was blocked with 5% BSA (Sigma, USA) at room temperature for 1 hour, then incubated overnight at 4 degrees with 1:1000 diluted GP73 antibody (purchased from SCBT, USA) and 1:2000 diluted horseradish peroxidase (HRP )-labeled goat anti-mouse IgG was incubated at room temperature for 1 hour, and chemiluminescence (ECL) detection was carried out in a dark room. The results showed that infected HepG2 co...
PUM
Login to view more Abstract
Description
Claims
Application Information
Login to view more - R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap