Method for producing Buthus martensii Karsch toxin AGAP
A production method and technology for scorpion toxins are applied in the field of medicine and biology to achieve the effects of improving productivity, saving costs and being easy to operate.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Embodiment 1: Preparation of recombinant scorpion venom protein AGAP
[0034] 1) Construction of SUMO-AGAP fusion gene by overlapping PCR technique
[0035]According to the SUMO gene sequence (Genebank no.U27233.1) and AGAP gene sequence (Gene bank no.AF464898.1) found in the NCBI database, primers were designed as follows:
[0036] P1: 5'CGATATA CCATGGGTCATCACCATTCATCACGGGTCGGACTCAG3'
[0037] P2: 5'CAATATAACCATCGCGTACACCTCCAATCTGTTCGCGGTG 3'
[0038] P3: 5' GGAGGT GTACGCGATGGTTATATTG 3'
[0039] P4: 5'AGAACTCTCGAGCTAACCGCCATTGCATTTTCC3'
[0040] Among them, P1 contains the NcoI restriction site, start code, His6 tag and SUMO upstream complementary sequence, P2 contains the downstream SUMO complementary sequence and AGAP upstream complementary sequence, P3 contains the upstream complementary sequence of AGAP, P2 and P3 contain complementary regions, and P4 contains AGAP downstream complementary sequence and BamHI restriction site and stop codon.
[0041] In the fi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
