Human tnfα monoclonal antibody, its pegized nanoparticle and application thereof

A monoclonal antibody and nanoparticle technology, applied in the field of biotechnology and medicine

Active Publication Date: 2011-12-28
优锐生物医药科技(深圳)有限公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008]In addition, although the human immune system can produce an extremely large variety of antibodies, the technology of human or fully human antibodies has encountered a bottleneck: the precursor of specific antibodies produced in the human body Cell abundance is low, and even in antibody-positive individuals, the number of precursor cells capable of producing specific antibodies is far below the number of specific antibody-producing cells required for human hybridoma technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human tnfα monoclonal antibody, its pegized nanoparticle and application thereof
  • Human tnfα monoclonal antibody, its pegized nanoparticle and application thereof
  • Human tnfα monoclonal antibody, its pegized nanoparticle and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Obtaining of B cells secreting anti-human TNFα antibody

[0025]Take 5 milliliters of peripheral blood from patients with active rheumatoid arthritis, separate leukocytes with lymphocyte separation medium, culture them, and identify positive clones according to the results of ELISA.

[0026] 1. Select blood sample

[0027] In order to obtain human B cells secreting anti-human TNFα, human TNFα (purchased from Shenzhen Jingmei Company) was used to routinely coat a 96-well plate, and each well was coated with 250ng of the protein overnight. Then, it was blocked with 5% skimmed milk powder at room temperature for 2 hours, and the milk powder was prepared with pH7.2 PBS. After washing, 100 microliters of sera from different patients were added and incubated at room temperature for 1 hour. Then add peroxidase-labeled goat anti-human IgG and let stand at room temperature for 1 hour. After washing at least 5 times, add TMD or other chromogenic reagents and treat at...

Embodiment 2

[0045] Example 2 Obtaining of anti-human TNFα antibody gene

[0046] Take 5000-10000 positive clone cells obtained in Example 1, use Trizol (GIBCO) to isolate total RNA, and use MMLV reverse transcriptase (Promega company product) to obtain cDNA. The above operations were carried out in accordance with the manufacturer's instructions. PCR was carried out with the following primers and conditions, and the amplification enzyme used was ClonTech's Pfu to ensure that possible mutations were reduced during amplification.

[0047] Light chain upstream primer: GACATCGAGCTGACCCAGTC (SEQ ID NO: 7)

[0048] Light chain downstream primer: CTAACACTCTCCCCTGTTGAAGC (SEQ ID NO: 8)

[0049] Heavy chain upstream primer: GAGGTGCAGCTGGTGGAGTC (SEQ ID NO: 9)

[0050] Heavy chain downstream primer: CTAGCATGTGTGAGTTTTGTCACAAG (SEQ ID NO: 10)

[0051] PCR conditions:

[0052] a) The composition of the reaction system:

[0053]

[0054]

[0055] b) Reaction conditions:

[0056] Pre-denat...

Embodiment 3

[0070] Example 3 Preparation of anti-human TNFα antibody

[0071] 1. Obtaining the coding sequence of human IgG1 heavy chain Fc fragment

[0072] In order to carry out the gene expression of the full-length antibody, we synthesized the heavy chain Fc sequence of human IgG1 in order to constitute the complete anti-human TNFα antibody gene. According to the literature, the DNA coding sequence of the Fc fragment of the human IgG1 heavy chain is as follows:

[0073] DNA sequence of human IgG1 Fc fragment (5'→3') (SEQ ID NO: 5)

[0074] ACATGCCCACCGTGCCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACC

[0075] CTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAAC

[0076] TGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTG

[0077] GTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAAACAAAGCCCTC

[0078] CCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCC

[0079]CGGGAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an anti-human TNFa monoclonal antibody, the amino acid sequence of its light chain is SEQ ID NO: 3, the amino acid sequence of the variable region of the heavy chain is SEQ ID NO: 4, and the full-length sequence of the heavy chain is represented by SEQ ID NO :6 encoded. The present invention further discloses the Fab antibody of the above-mentioned anti-human TNFa monoclonal antibody. In addition, the present invention adopts methods such as PEGylation and nanotechnology to transform and modify in vitro to obtain PEGylated antibodies and PEGylated anti-human TNFa monoclonal antibody nano Particles, and further discloses the application of the above antibodies or antibody nanoparticles. The anti-TNF monoclonal antibody provided by the present invention is a fully human antibody sequence, has low immunogenicity, few side effects, and low production cost. It adopts nanoparticle preparation technology, surface modification technology, and technology such as bridging with small-molecule antibodies to prolong the production process. The purpose of sustained release in vivo avoids the shortcoming of the short half-life of small molecule antibodies, and makes it more suitable for in vivo application while maintaining its anti-TNF activity.

Description

technical field [0001] The invention relates to the fields of biotechnology and medicine, in particular to an anti-human TNFα monoclonal antibody and its PEGylated nanoparticles and applications thereof. Background technique [0002] Autoimmune diseases are the third largest group of diseases after cancer and cardiovascular diseases. Rheumatoid arthritis (RA) is one of the most common autoimmune diseases. The prevalence rate of rheumatoid arthritis in my country is about 0.32-0.36%, and the incidence rate among people over 60 years old is as high as 30%-40%. Faced with hundreds of thousands of yuan per person per year for imported drug treatment, patients often have to endure painful chemical treatment for a long time, but with little effect. [0003] RA has a large number of patients and a large amount of medication, which makes the market for therapeutic drugs huge. In 2005, the global market reached 6 billion US dollars. At present, there are many clinical treatment op...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K16/24C07K1/107A61K39/395A61P37/02A61P19/02A61P29/00
Inventor倪健
Owner优锐生物医药科技(深圳)有限公司