Unlock instant, AI-driven research and patent intelligence for your innovation.

Rice leaf-shaped regulatory gene NRL1 and application thereof

A technology for regulating genes and rice, applied in genetic engineering, plant genetic improvement, application, etc., can solve problems such as inability to prove practically, and achieve the effects of improving light energy utilization efficiency, improving leaf shape, and increasing yield

Inactive Publication Date: 2010-09-29
CHINA NAT RICE RES INST
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The prediction of gene sequence does not necessarily lead to accurate gene sequence (of course, some predictions are accurate); what function does the gene play, although the function of the gene can be deduced through software and homology analysis, it cannot be actually proved, and The gene doesn't necessarily work in this way

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice leaf-shaped regulatory gene NRL1 and application thereof
  • Rice leaf-shaped regulatory gene NRL1 and application thereof
  • Rice leaf-shaped regulatory gene NRL1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] 1. Rice material:

[0042] The three rice (Oryza sativa L.) narrow rolled leaf mutants nrl1 (narrow and rolled leaf 1) in the present invention are all obtained by EMS (Ethyl Methane Sulphonate) mutagenesis. Among them, the original wild material of nrl1-1 is the japonica rice variety Nipponbare. The allelic mutants nrl1-2 and nrl1-3 are japonica rice varieties Nipponbare and Wuyunjing 7, respectively.

[0043] 2. Analyze and target groups:

[0044] The homozygous nrl1-1 mutant was crossed with the indica rice variety Nanjing 6, F 1 Generation selfing, get F 2 population, and 1138 nrl1-1 mutant individuals were selected as the mapping population. At the tillering stage, about 1 gram of young leaves were taken from each plant to extract the total DNA.

[0045] 3. Molecular marker localization of NRL1 gene

[0046] Genomic DNA for gene localization was extracted from rice leaves by a rapid extraction method of rice trace DNA. About 0.2g of rice leaves were taken, fro...

Embodiment 2

[0060] Plant Transformation:

[0061] The SwaI restriction site was introduced into the multiple cloning site of the pCAMBIA1300 vector by PCR technology. The amplification primers were: F: CGAGGTTATGGATCCATTTAAATAAAATCTT, R: GGGAGCATGC CATTTGGTATTC, and the annealing temperature was 59.7°C-59.8°C. Among them, the front primer contains restriction sites of BamHI (G / GATCC) and SwaI (ATTT / AAAT), and the rear primer contains restriction sites of SphI (GCATG / C). Use this primer to PCR amplify Nipponbare genomic DNA, recover and purify a fragment of 498bp (named as SEQ ID NO: 3) after electrophoresis, carry out double enzyme digestion with BamHI and SphI on this fragment, and simultaneously use these two endonucleases to pCAMBIA1300 Carry out partial digestion of the vector, and then connect the products of the correct size fragments after the digestion of the two enzymes, so that the restriction site of SwaI is introduced after the multiple cloning site BamHI of the pCAMBIA1300 ve...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a protein encoded by a rice leaf-shaped regulatory gene NRL1, which has an amino acid sequence shown in SEQ ID NO:2. The invention also discloses a gene for encoding the protein, which has a nucleotide sequence shown in SEQ ID NO:1. The rice leaf-shaped regulatory gene NRL1 can be used for improving the width or the crimpness of rice leaves.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. Specifically, the present invention relates to a clone of rice NRL1 (NARROW AND ROLLED LEAF 1) gene using map-based cloning technology, and the identification of the function of the gene using transgene complementation experiments; The degree of regulation of leaf shape is used to improve rice varieties to increase yield. Background technique [0002] Leaf is the main vegetative organ for photosynthesis of plants, and it is also an important part of ideal plant shape. In the current high-yield breeding, the leaf inclination, especially the flag leaf inclination, has a significant impact on the photosynthetic production of rice, and the appropriate curl or bump of the leaves can make the leaves straight, reduce the leaf inclination, and increase the light transmittance of the population , Increase the ventilation, and the sufficient light in the middle and late stages is more conducive t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N15/82C12N1/21C12N5/10A01H5/00A01H4/00
Inventor 钱前胡江曾大力张光恒郭龙彪朱丽颜美仙董国军高振宇
Owner CHINA NAT RICE RES INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More