Supercharge Your Innovation With Domain-Expert AI Agents!

Method for preparing human interleukin 28A by silkworm bioreactor and pharmaceutical application thereof

A bioreactor and human interleukin technology, applied in biochemical equipment and methods, botany equipment and methods, interleukin, etc., to achieve the effects of shortened time, simple preparation process, high transposition and purification rate

Inactive Publication Date: 2010-09-29
SUZHOU UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are no reports on the expression of human interleukin (interleukin) 28A using the silkworm baculovirus expression vector system, and reports on oral preparations of human interleukin (interleukin) 28A

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing human interleukin 28A by silkworm bioreactor and pharmaceutical application thereof
  • Method for preparing human interleukin 28A by silkworm bioreactor and pharmaceutical application thereof
  • Method for preparing human interleukin 28A by silkworm bioreactor and pharmaceutical application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1: Preparation of Bombyx mori larvae expressing hIL-28A

[0025] 1. According to the cDNA sequence of hIL-28A published by GenBank (GenBank accession number: BC113583), the coding sequence of hIL-28A gene was synthesized and cloned into T-vector to obtain pUC-hIL-28A plasmid.

[0026] 2. Design and synthesize primer pair IL-28A-1 (TA GGATCC ATGAAACTAGACATGAC, the underline is the BamH I site) and IL-28A-2 (TT GAATTC AGACACACAGGTCCCCACTG, the underline is the EcoR I site). Using the pUC-hIL-28A plasmid as a template, digest it with BamH I / EcoR I double enzymes, recover the hIL-28A fragment, and connect it with the donor plasmid pFastBac-Dual (Invitrogen Company) digested with the same enzyme to obtain the pFastBac-Dual-hIL28A plasmid , the plasmid transformed Escherichia coli BmDH10Bac competent cells, coated with tetracycline (10 μg / ml), kanamycin (50 μg / ml), gentamicin (7 μg / ml), IPTG (40 μg / ml), X -gal (100μg / ml) LB agar culture plate. Pick white colony ...

Embodiment 2

[0030] Example 2: Preparation of silkworm chrysalis expressing hIL-28A

[0031] 1. Use the recombinant virus BmNPV-hIL-28A obtained in step 3 of Example 1 to infect BmN cultured cells, and collect the cell culture supernatant after 4 days.

[0032] 2. Take the cell culture supernatant of step 1 with an insect needle, puncture and inoculate the silkworm chrysalis before compound eye coloring, protect it at about 25°C for 5 days, and take a small amount of silkworm blood. IL-28A ELISA kit (USCN and LIFETECHNOLOGY company) was used to measure the expression level of hIL-28A, and the amount of recombinant hIL-28A per milliliter of hemolymph reached 33 μg. The silkworm pupae were collected 5 days after virus inoculation and stored at -20°C.

Embodiment 3

[0033] Example 3: Preparation of lyophilized powder of silkworm chrysalis expressing hIL-28A

[0034] 1. Get 5 kg of silkworm chrysalis from Step 2 of Example 2, homogenate in an ice bath, add 20 kg of 0.7% physiological saline, mix well, and filter with gauze to remove coarse impurities.

[0035] 2. The filtrate was lyophilized into a powder material, and ELISA assay showed that each gram of the lyophilized powder contained 8.5 mghIL-28A.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene engineering, in particular to a method for preparing human interleukin 28A by a silkworm bioreactor. Recombined silkworm Bombyx mori recombinant baculovirus with a human interleukin 28A (hIL-28A) gene is obtained by an gene engineering method and is used for inoculating silkworm larvae or pupae, so that the human interleukin 28A is expressed with high efficiency in the silkworm larvae or pupae. Because the invention uses the silkworm bioreactor to produce the recombinant human interleukin 28A (hIL-28A), silkworms can be edible or medicinal, the silkworm larvae and pupae expressing the hIL-28A can be directly freeze-dried, and an expression product does not need to be purified and can be directly used as an oral medicine, so that the invention has the advantages of simple preparation process, low cost, convenient use of the oral medicine and the like and can also reduce some side effects of an injection medicament form.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for preparing human interleukin 28A using a silkworm bioreactor and its pharmaceutical application. Background technique [0002] Human interleukin (interleukin) 28A (hIL-28A) is a new type of interferon lambda (IFN-λ), which has similar functions to class I interferon (IFN), and has antiviral, antiproliferative and immunomodulatory activities . Human natural interleukin is obtained by separately stimulating lymphoblasts and human leukocytes, and then purifying them. Currently, only interferon produced by lymphoblastoid cells is available in the market, which is a natural multi-subtype mixture. Clinical use is mainly recombined preparations, and the main dosage forms are powder and water. There is no oral dosage form, and the use is injection. [0003] The Bombyx mori baculovirus expression vector system is a eukaryotic expression system in which many genes have bee...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/24C12N15/866C07K14/54A61K38/20A61P31/12A61P35/00A61P37/02
Inventor 贡成良陆叶郑小坚薛仁宇曹广力
Owner SUZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More