Method for preparing recombinant duck alpha-interferon

A crude technology of interferon, applied in the field of preparation of recombinant duck α-interferon, can solve the problems of hyperimmune serum carrying and spreading other diseases, decreased protection rate, no protective effect, etc. Reduce production costs, no toxic side effects

Inactive Publication Date: 2012-07-04
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to address the problems of duck virus disease prevention and treatment, such as the potential risk of carrying and spreading other diseases in the use of hyperimmune serum due to the occurrence of mutated strains due to the long-term use of conventional vaccines, resulting in a decrease in protection rate or even no protective effect; Inexpensive, safe and effective, non-toxic and side effects, short retention time in the body, no drug residue, recombinant duck α-interferon with double effect on duck viral diseases, especially duck viral hepatitis, high renaturation rate preparation method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing recombinant duck alpha-interferon
  • Method for preparing recombinant duck alpha-interferon

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1: (the synthesis of duck α-interferon gene and the construction of expression vector)

[0035] (1) Duck α-interferon gene synthesis: The duck α-interferon gene sequence published by Genebank (No. X84764) was sent to Shanghai Boya Biotechnology Co., Ltd. for synthesis. The synthetic duck α-interferon gene has removed the signal peptide gene and is a mature duck α-interferon protein gene, and its sequence is as follows:

[0036] tgcagccccctgcgcctccacgacagcgccttcgcctgggacagcctccagctcctccgcaacatggc

[0037] tcccagccccacacagccctgcccgcagcaacacgcgccttgctccttcccggacaccctcctggaca

[0038] ccaacgacacgcagcaagccgcacacaccgccctccacctcctccaacacctcttcgacaccctcagc

[0039]agccccagcacccccgcgcactggctccacaccgcacgccacgacctcctcaaccagcttcagcacca

[0040] catccaccaccttgagcgctgcttcccagccgacgccgcgcgcctccacaggcgagggccccgcaacc

[0041] ttcacctcagcatcaacaagtacttcggctgcatccaacacttcctccagaaccacacctacagcccc

[0042] tgcgcatgggaccacgtccgcctcgaggctcacgcctgcttccagcgcatccaccgcctcacccgcac ...

Embodiment 2

[0049] Example 2: (engineering bacteria induced expression, inclusion body extraction, protein purification and renaturation)

[0050] (1) Induced expression of engineering bacteria: inoculate the LB culture fluid containing 50ug / ml kana with the engineering bacteria of embodiment 1 and cultivate overnight at 37°C, and in the next day, the bacterial fluid is inoculated with the above-mentioned same LB medium by the inoculum of 2%. , cultured at 37°C to OD 600 If the value is 0.6-0.7, add an IPTG inducer with a final concentration of 1 mmol to induce culture for 4 hours; take the bacterial solution and centrifuge at 4000 rpm for 10 minutes to collect the bacterial cells, and store them in a -70°C refrigerator for later use;

[0051] (2) Inclusion body extraction: resuspend the collected bacteria with the lysis buffer prepared by 50mM phosphate buffer, 300mM NaCl, 10mM β-mercaptoethanol, pH 7.8 at a ratio of 1:4 by weight; use a high-pressure homogenizer at 650 Under Pa pressur...

Embodiment 3

[0054] Embodiment 3: (determination of crude duck α-interferon biological activity)

[0055] Using the micro-cytopathic inhibition method, detect the activity of the expression product on the duck embryo fibroblast cell line with vesicular stomatitis virus VSV: first, the expression product of Example 2 is diluted 10 times to 1000 times with MEM cell culture medium and then diluted To 64,000 times, add to duck embryonic fibroblasts (DEFs) in a monolayer on a 96-well cell culture plate, 20ul per well, 5 wells for each dilution, add 160ul of MEM maintenance solution, and culture at 37°C for 24 hours Pour off the culture medium and inoculate 100 TCID 50 VSV (20ul per well), after adding 160ul of MEM maintenance solution, continued to culture for 96h; it was found that 100 TCIDs were inoculated 50 After VSV, the control group 1 treated with refolding solution (50mM acetic acid buffer, 50mM NaCl, pH 7.0) and the control group 2 without any treatment just appeared the lesions such ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
purityaaaaaaaaaa
Login to view more

Abstract

The invention discloses a method for preparing recombinant duck alpha-interferon, and belongs to the technical field of biological pharmaceutics. The method comprises the following steps of: (1) synthesizing a duck alpha-interferon gene; (2) designing and synthesizing a primer; (3) constructing an expression vector; (4) performing induction expression on engineering bacteria; (5) extracting, purifying and renaturing an expression product; and (6) determining biological activity and the like. The purity of a recombinant duck alpha-interferon preparation is over 90 percent; the half protective number of each milliliter of cells is over 105u; clinical application proves that relative cure rate is over 93 percent; the preparation has the advantages of low cost, good social benefit and application prospect, and popularization and application in duck farms and poultry pharmaceutical enterprises; and a new safe and effective medicament without any toxic or side effect is provided for treating duck viral hepatitis.

Description

technical field [0001] The invention relates to the technical field of biopharmaceuticals, in particular to a preparation method of recombinant duck α-interferon. Background technique [0002] The duck industry has a long history in our country, and it ranks among the best in the world in terms of duck species resources and production quantity. With the rapid development of the duck industry and the large-scale circulation of duck products, new and old diseases such as duck plague, duck viral hepatitis, muscovy duck parvovirus, duck flu, muscovy duck reovirus and new duck viral hepatitis are rapidly increasing. Among them, viral diseases have become the main epidemic diseases of duck industry in my country, seriously threatening the healthy development of duck industry. For viral diseases, there is no highly effective therapeutic drug at present, and vaccine immunization and passive immunization with hyperimmune serum are still the main means of preventing and treating viral...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/21C12N15/70C07K14/56C07K1/14
Inventor 张存叶伟成刘蔓雯张燕
Owner ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap