Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit for detecting 7 hot mutant sites of phenylketonuria PAH gene and PCR amplification method thereof

A technology for phenylketonuria and mutation sites, applied in the field of clinical detection technology, can solve the problems of difficult popularization and application, high cost, and low efficiency, and achieve high throughput, automation, and simple operation

Active Publication Date: 2012-07-25
SUZHOU KUANGYUAN MOLECULAR BIOTECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, many scientific research institutions and biotechnology companies in the world are committed to the research of gene mutation detection, and many effective detection methods have been developed, such as PCR-SSCP, TGGE, DGGE, SNaPshot, HRMA, molecular beacons, DNA direct sequencing etc. However, the disadvantages of these methods are that they are time-consuming, costly, and inefficient, making it difficult to widely apply them.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting 7 hot mutant sites of phenylketonuria PAH gene and PCR amplification method thereof
  • Kit for detecting 7 hot mutant sites of phenylketonuria PAH gene and PCR amplification method thereof
  • Kit for detecting 7 hot mutant sites of phenylketonuria PAH gene and PCR amplification method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0103] Embodiment one: a kind of test kit that detects seven hotspot mutation sites of phenylketonuria PAH gene, described kit: by 10 * PCR Buffer, dNTP (each 2.5mM), MgSO 4 (25mM), seven sets of primers (10mM each) and Pfu DNA polymerase (5U / μl).

[0104] The seven sets of primers refer to seven sets of primers for detecting seven hotspot mutation sites of R111X, IVS-4-1, Y204C, R243Q, W326X, Y356X and R413P;

[0105] The first group: the nucleotide sequence of the primers for detecting the R111X hotspot mutation site is as follows:

[0106] Mutation template paired primer R111X M:

[0107] 5'-ACCTGTGTCTTTCTTCTTATCTC*AA-3';

[0108] Normal template pairing primer R111X N:

[0109] 5'-ACCTGTGTCTTTCTTCTTATCTC*GA-3';

[0110] Common upstream or downstream primer R111X C:

[0111] 5'-TGCCCCACCTCCTGCCACTT-3';

[0112] Wherein, the phosphodiester bond between the -3 and -2 bases at the 3' end of the mutant template matching primer R111X M and the normal template matching prim...

Embodiment 2

[0158] Embodiment two: a kind of PCR amplification method that adopts the kit described in embodiment one to detect phenylketonuria PAH gene hotspot mutation site, comprises the following steps:

[0159] Step 1: Prepare DNA

[0160] (1) Blood is drawn from two human bodies to obtain two blood samples.

[0161] (2) Obtaining DNA from two blood samples, that is, preparation of genomic DNA samples of white blood cells in the blood samples.

[0162] Reagent preparation:

[0163] Anticoagulant: Each 100ml anticoagulant contains 0.48g citric acid, 1.32g sodium citrate, and 1.47g glucose.

[0164] Red blood cell lysate: 10mmol / L Tris-HCl, pH 7.6;

[0165] 5mmol / L MgCl 2 ;

[0166] 10mmol / L NaCl;

[0167] White blood cell lysate: 10mmol / L Tris-HCl, pH 7.6;

[0168] 10mmol / L EDTA (pH 8.0)

[0169] 50mmol / L NaCl

[0170] 10mg / ml proteinase K (Protease K): 10mg Protease K dissolved in 1ml ddH 2 O (double distilled water), aliquoted and stored at -20°C. When in use, melt at 4°C. ...

Embodiment 3

[0203] Embodiment 3: A PCR amplification method for detecting hotspot mutation sites of PAH gene in phenylketonuria using the kit described in Embodiment 1

[0204] The experimental conditions and judgment methods are the same as in Example 2, and there are two blood samples (different from Example 2).

[0205] The following set (two pairs) of primers were used to detect the mutation site of IVS-4-1 (AG→AA). The size of the product fragment corresponding to each pair of primers was 176bp, and its nucleotide sequence was (5’→3’):

[0206] ①. Mutation template matching primer pair:

[0207] Mutation template paired primer IVS-4-1M: CAGGTGTCTCTTTTCTCCTA*AC

[0208] Common upstream or downstream primer IVS-4-1C: TTCCATCCTCAACTGGATGA

[0209] ②, normal template matching primer pair:

[0210] Normal template paired primer IVS-4-1N: CAGGTGTCTCTTTTTCTCCTA*GC

[0211] Common upstream or downstream primer IVS-4-1C: TTCCATCCTCAACTGGATGA

[0212] Note: The phosphodiester bond marked ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a kit for detecting 7 hot mutant sites of a phenylketonuria PAH gene and a PCR amplification method thereof. The invention is characterized in that in the PCR reaction in which high-fidelity DNA polymerase participates, the product of a mutation detection primer which is modified in a 3'-5' exonuclease digestion resistance way, has very high specificity, and people can directly observe the existence of the strips obtained by gel electrophoresis to judge the genotype of the corresponding mutant sites of the PAH gene. The invention has the advantages of simple operationand economical performance, does not need sequencing, and can be operated in a common molecular biology laboratory. The method of the invention is combined with the fluorescence quantitative PCR technology, and can realize automation and high flux of clinic detection of the biological sample, thereby greatly enhancing the detection accuracy and efficiency.

Description

technical field [0001] The invention relates to a kit for detecting seven hotspot mutation sites of PAH gene in phenylketonuria and a PCR amplification method thereof. The detection result can be used for clinical auxiliary diagnosis of phenylketonuria, and belongs to the clinical detection technology in the field of biomedicine . Background technique [0002] Phenylketonuria (Phenylketonuria, PKU) was first discovered by Asbjorn Folling in 1934. He used the classic organic chemical analysis method to find that the patient's urine contained a large amount of phenylpyruvate, phenyl Hence the name acetonuria. PKU is an autosomal recessive genetic disease caused by defects in amino acid metabolism. The incidence rate is about 1 / 10000, and the frequency of heterozygosity is about 1 / 50. One (the other is hypothyroidism). [0003] The clinical manifestations of children with this disease are normal at birth, but if they have not passed the statutory screening and low-phenylalan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 秦正红王进李红陈瑛何晓辉
Owner SUZHOU KUANGYUAN MOLECULAR BIOTECH