Construction and application of E2 gene-based insertable swine fever virus cDNA vector

A kind of swine fever virus, plug-in technology, applied in the direction of recombinant DNA technology, application, genetic engineering, etc.

Inactive Publication Date: 2012-07-18
ZHEJIANG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

After immunizing pigs with this recombinant virus, it has no pathogenicity and can produce specific antibodies against the current type 2 epidemic strain E2

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and application of E2 gene-based insertable swine fever virus cDNA vector
  • Construction and application of E2 gene-based insertable swine fever virus cDNA vector
  • Construction and application of E2 gene-based insertable swine fever virus cDNA vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Embodiment 1 covers the amplification of CSFV vaccine C strain full-length genome cDNA fragment

[0021] According to the genome sequence of classical swine fever virus, primers with specific restriction sites were designed in the conserved region.

[0022] The primer sequences are as follows:

[0023] F1-upnew: 5-GTATACGAGGTTAGTTCATTCTCG

[0024] F1-lownew: 5-GCCTTGTGCCCCAGTTACT

[0025] F1-upper: 5-AA TCTAGA GTATACGAGGTTAGTTCATTCTC

[0026] F1-lower: 5-AAA ACTAGT AACAGCCATACCACAC

[0027] F2-upnew: 5-GCTTGATAAAAGTATTAAGAGGACAG

[0028] F2-lownew: 5-AACTCGTAAGTGGGCAGTATGA

[0029] F2-upper: 5-ACGG ACTAGT AACTGGGGCACAAGGC

[0030] F2-lower: 5-GGG CTGCAG TGGAAATAAGGTACACGAGAA

[0031] F3-upnew: 5-TTAATAAGGGTGCTGAAGGGAATAGGTGAG

[0032] F3-lownew: 5-CCACATCCAAGTCCGGGAGAGTAA

[0033] F3-upper: 5-AAA GCGGCCGC CTGCAGTGGTAACAAGAT

[0034] F3-lower: 5-GCA GTC GAC GGATCCTCACCACTATAATA

[0035] F4-upnew: 5-GATTAAAGATACCAGTAGAGGAGATGAAGA

[0036] F4-lown...

Embodiment 2

[0049] Embodiment 2 Transformation of the required plasmid for full-length cDNA cloning

[0050] Using pBR322 (purchased from Promega) as a template for transformation, the plasmid pB-CN for cloning the 3′-half length of the CSFV genome was obtained. Specific steps are as follows:

[0051] Apply primer pGEM-U:GGG GGATCCTATAGGGCGAATTGG and pGEM-L:CCG CAAGCTATTTAGGTGACAC amplified the 17lbp fragment containing the plasmid pGEM-5ZF(+) (purchased from Promega) and the multiple cloning site, and introduced restriction sites HindIII and AvaI respectively before and after the fragment. Since the fragment encoding kana resistance in the pBR322 plasmid also contains the corresponding two enzymes, the fragment can be excised by using these two enzymes, and the 171bp fragment is cloned at the corresponding position to obtain the medium-copy plasmid pB- CN.

[0052] The low-copy plasmid pACYC-177 (purchased from NEB Company) was used as a template for transformation to obtain the pl...

Embodiment 3

[0054] The construction of embodiment 3 full-length cDNA vectors

[0055] Assembly of CSFV 5'-half-length: first clone F1, F2 and F3 fragments into plasmid pA or pGEM-5ZF(+) with restriction endonucleases XbaI / SpeI, SpeI / PstI and NotI / SalI respectively to obtain the corresponding Recombinant plasmids F1-pA, F2-pGEM and F3-pGEM. A promoter of T7 RNA polymerase was introduced upstream of the 5'-noncoding region of the genome of the F1 fragment for in vitro transcription of the full-length cDNA. Then, F3 was excised from F3-pGEM with PstI and SalI, and cloned into F2-pGEM with the same enzyme to obtain recombinant plasmid F23-pGEM. Then use SpeI and BamHI to excise F23 from F23-pGEM, and clone F1-pA with the same enzyme to obtain recombinant plasmid F123-pA containing CSFV 5'-half-length.

[0056] Assembly of CSFV 3′-half-length: firstly clone F4 and F5 fragments into plasmid pB with restriction endonucleases BamHI / NcoI and NcoI / NotI, respectively, to obtain corresponding recom...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology and aims at providing construction and application of an E2 gene-based insertable swine fever virus cDNA vector. The construction method comprises the following steps of: with a half-long recombinant plasmid pA-F123 containing a swine fever viral vaccine C strain genome 5' as a template, carrying out enzyme digestion by using restriction enzymes of SpeI and NsiI, recovering an enzyme digestion product through rubber tapping and obtaining a purified pA-deltaE2-F123 plasmid; and cutting off a half-long F456 segment containing wine fever viral vaccine C strain genome 3' from Pb-f456 by using BanHI and SaII and cloning into the pA-deltaE2-F123 to obtain the recombinant plasmid pA-deltaE2-FL22. The insertable cDNA vector constructed by the invention can be used for quickly and conveniently rescuing recombinant C strain viruses carrying E2 genes with different genotypes according to the epidemic situation of the swine fever; and a probe label sequence introduced in the recombinant virus E2 genes can be applied to a fluorescence quantitative PCR differential detection method. The rescued recombinant virus remains the characteristicsthat the C strain is coped in a rabbet body and has no virulence in a natural host of swine and the like.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to the construction and application of an insertable swine fever virus cDNA vector based on E2 gene. Background technique [0002] Classical swine fever (CSF) is a highly contagious infectious disease of pigs. Although all countries attach great importance to the prevention and control of swine fever, due to the current intensification of pig farming and the globalization of live pig trade, swine fever still poses a serious threat to the global swine industry. The causative agent of classical swine fever is classical swine fever virus (CSFV), which is a member of the Pestivirus genus in the Flaviviridae family and is an enveloped single-stranded positive-sense RNA virus. The genome is about 12.3kb long, with 5'-end and 3'-end non-coding regions at both ends, and coding region in the middle, including 4 structural proteins and 8 non-structural proteins, of which only envelope glycoprote...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/63C12N15/40C12N15/65
Inventor方维焕陈宁李肖梁童超李得江袁雪梅万婧
OwnerZHEJIANG UNIV