Maize water-logging tolerance-related transcription factor gene zm-bRLZ, molecular marker and application

A technology of transcription factor and water tolerance, applied in the field of plant biology, can solve the problems of enhancing long-term adaptive response of Arabidopsis thaliana and the premature death of transformed plants.

Inactive Publication Date: 2011-02-16
HUAZHONG AGRI UNIV
View PDF1 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

2) Introduce anaerobic-induced transcription factors such as AtMYB2 gene, start the expression of related genes in fermentation pathway and other metabolic pathways, and enhance the long-term adaptive response of Arabidopsis to hypoxia stress (Hoeren et al., 1998), but AtMYB2 Constitutive overexpression leads to premature death of transformed plants (Dolferous et al., 2003)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Maize water-logging tolerance-related transcription factor gene zm-bRLZ, molecular marker and application
  • Maize water-logging tolerance-related transcription factor gene zm-bRLZ, molecular marker and application
  • Maize water-logging tolerance-related transcription factor gene zm-bRLZ, molecular marker and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Obtaining zm-bRLZ by cDNA chip screening

[0027] (1) The differentially expressed gene zm-bRLZ was obtained by microarray screening

[0028] In the present invention, two corn inbred lines, Mo17 with poor water resistance and Hz32 with strong water resistance, are selected as test materials. After the seeds germinate, they are potted in sand pots until the stage of two leaves and one heart. A number of individual plants with the same growth were selected and divided into two groups on average. One group was used as a control and grown under normal water and management conditions; the other group was grown in 1× complete culture solution [component: Ca(NO 3 )2 820.7mg / L, KNO 3 505.6mg / L, MgSO 4 ·7H 2 O 616.2mg / L, KH 2 PO 4 272.2mg / L, Fe-EDTA 13.02mg / L, H 3 BO 3 2.860mg / L, MnSO 4 1.015mg / L, CuSO 4 ·5H 2 O 0.079mg / L, ZnSO 4 ·7H 2 O 0.220mg / L, H 2 MoO 4 0.090mg / L] for 1h, 2h, 4h and 8h of flooding treatment, and the depth of flooding should ...

Embodiment 2

[0035] Example 2: Gene structure and function prediction of zm-bRLZ

[0036] (1) Rapid amplification of cDNA ends (RACE) to isolate zm-bRLZ full-length cDNA

[0037] Trizol kit (purchased from Invitrogen, USA) was used to extract total RNA from the root system of Hz32 seedlings (for the operation method, refer to the manual of the kit) for the first strand synthesis of 5′-RACE and 3′-RACE cDNA, RACE technology The operation steps, reaction system and reaction program of the analysis were all in accordance with the operation method of the SMART RACE cDNA Kit amplification kit (purchased from Invitrogen, USA) referring to the kit’s manual. The primers were GSP1: TCCTAGTAAATCCAACCCTGTGAGC; NGSP1-1: TGCCTGTTTCTCTCCTCCTAGACCGCC; GSP2: TCCAGCAACTTTCAGATGCCAACCAA; NGSP2-1: GGGGTCCAACCGCAGGTACACGAGTA.

[0038] (2) Analysis of zm-bRLZ gene structure:

[0039] Based on the full-length cDNA, four pairs of primers (numbered bRLZ-1 to bRLZ-8, respectively, and the DNA sequences of the pr...

Embodiment 3

[0044] Example 3: In vitro expression of zm-bRLZ and analysis of its binding to anaerobic response elements

[0045] The upstream and downstream primers are: GTGGAATTCTAAGAAGTGCGCGTCGGAGCTG; TCAAGGCCAAATGTCCGCCGCCGAGCTCGA (where the underline is the restriction site), and the cDNA is used as a template for PCR amplification. The PCR product was recovered and purified, and inserted into the pGEX-KG vector ( Figure 5 ), construct the zm-bRLZ::GST structure, transform Rosseta host bacteria (Invitrogen, USA), and screen positive clones with ampicillin concentration of 100 μg / ml+LB plate. Add isopropylthiogalactopyranoside (IPTG) at a final concentration of 0.2mmoL / L to the positive clone LB liquid to induce at 4°C overnight, then centrifuge at 8000g for 10 minutes at 4°C to collect the precipitated bacteria. Take 1-2g bacteria and add 10mL breaking buffer (pH7.4, 50mM phosphate buffer: containing 0.5M NaCl, 0.5mg / mL lysozyme, 1mM phenylmethylsulfonyl fluoride PMSF, 1mM MgCl2, 1....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of plant gene engineering, and relates to clone and application of a maize water-logging tolerance-related transcription factor gene zm-bRLZ. The nucleotide sequence of the gene is shown as SEQ ID No. 1, and the gene has a total length of 4,027bp and comprises 6 exons. The cDNA sequence of the gene is shown as SEQ ID No. 2, and 282 amino acids are encoded on the gene. In flooding stress, the expression of the gene in maize inbred line Hz32 seedling roots is up-regulated and the expression level of the gene in the Mo17 is kept unchanged. The in-vitro combination of a gene protein product and an antidiuretic hormone (ADH) promoter anaerobic response factor shows that the zm-bRLZ gene has a regulation and control effect on an anaerobic induced gene. A pair of cleaved amplified polymorphic sequence (CAPS) markers is developed by utilizing zm-bRLZ gene sequence difference of the maize water-logging tolerance inbred line Hz32 and high-sensitivity K12. The gene is positioned at a water-logging tolerance quantitative trait locus (QTL) peak part of 9.04bin by utilizing K12*Hz32 F2 group. A candidate gene correlation analysis proves that a zm-bRLZ gene promoter region and a plurality of single nucleotide polymorphism (SNP) sites at a 3'-untranslated region (3'-UTR) are all obviously associated with a plurality of water-logging tolerance indexes.

Description

technical field [0001] The invention relates to the field of plant biotechnology. It specifically relates to the cloning of a transcription factor gene zm-bRLZ, which is located on the 9th chromosome of maize and is related to waterlogging tolerance of maize seedlings, and the development and application of its functional markers. Background technique [0002] Spring corn in the south and summer corn in the north often suffer from floods and waterlogging during the normal cultivation season. Long-term waterlogging makes the corn root system in a low-oxygen state, resulting in a reduction in corn yield. Waterlogging has become an important abiotic stress factor restricting the high and stable yield of maize. Breeding waterlogging-tolerant maize varieties is an effective way to reduce losses caused by flooding stress. [0003] Many studies have shown that there are genetic differences in waterlogging tolerance among maize inbred lines, which provide genetic resources for gen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68A01H5/00C12N15/11C12N15/29
Inventor张祖新邹锡玲邱法展姜媛媛郑用琏
OwnerHUAZHONG AGRI UNIV