Construction method of HBV (Hepatitis B Virus) isolating strain replicating-form plasmid
A technology of hepatitis B virus and construction method, which is applied in the field of construction of hepatitis B virus isolate replicating plasmid, can solve the problems of phenotype research, HBV replication and expression, etc.  Improve the efficiency of clone construction and simplify the operation method
- Summary
 - Abstract
 - Description
 - Claims
 - Application Information
 
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] (1) Extraction, PCR amplification and clone construction of the full-length HBV genome. HBV DNA was extracted using a virus genome extraction kit, and the full-length genome was amplified by PCR. Two restriction sites, BspQI and XbaI, were added to the amplification primers at the same time. The primers were as follows:
[0022] P1FULL: CCGG TCTAGA GCTCTTC tttttcacctctgcctaatca
[0023] P2FULL: CCGG TCTAGA GCTCTTC aaaaagttgcatggtgctgg
[0024] The reaction system is:
[0025] 10×PCR buffer 5μl
[0026] dNTP mix (10mM) 1μl
[0027] Primer 1 (25pM) 1μl
[0028] Primer 2 (25pM) 1μl
[0029] Pfu enzyme (2U / μl) 1μl
[0030] HBVDNA 10μl
[0031] Add ddH2O to 50μl
[0032] The reaction system was 95°C for 5 minutes, 95°C for 40s→58°C for 30s→72°C for 180s, cycled 35 times, and finally kept at 72°C for 10 minutes.
[0033] After gel electrophoresis, the product was purified with a 3.2kb band, reacted with Taq enzyme + dATP at 72°C for 15 minutes, added A at the end, mi...
PUM
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More - R&D
 - Intellectual Property
 - Life Sciences
 - Materials
 - Tech Scout
 
- Unparalleled Data Quality
 - Higher Quality Content
 - 60% Fewer Hallucinations
 
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
