Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method of HBV (Hepatitis B Virus) isolating strain replicating-form plasmid

A technology of hepatitis B virus and construction method, which is applied in the field of construction of hepatitis B virus isolate replicating plasmid, can solve the problems of phenotype research, HBV replication and expression, etc. Improve the efficiency of clone construction and simplify the operation method

Inactive Publication Date: 2011-03-30
RUIJIN HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, most of the HBV replicating plasmids used at home and abroad are 1.1-HBV vectors from laboratories in France and the United States, but the elements that initiate transcription on the vectors are all exogenous promoters and POLYA signals, which have certain limitations. : (1) The effect of foreign elements on HBV replication and expression is not clear; (2) The promoter of HBV is not a strictly conserved region, and the common clinical mutations of 1762 and 1764 occur in the promoter region. 1.1-HBV vectors that cannot phenotype variants in the above regions
Moreover, most of the HBV strains of domestic replicating plasmids come from foreign samples, and their serotypes and genotypes are quite different from those of domestic strains.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of HBV (Hepatitis B Virus) isolating strain replicating-form plasmid
  • Construction method of HBV (Hepatitis B Virus) isolating strain replicating-form plasmid
  • Construction method of HBV (Hepatitis B Virus) isolating strain replicating-form plasmid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] (1) Extraction, PCR amplification and clone construction of the full-length HBV genome. HBV DNA was extracted using a virus genome extraction kit, and the full-length genome was amplified by PCR. Two restriction sites, BspQI and XbaI, were added to the amplification primers at the same time. The primers were as follows:

[0022] P1FULL: CCGG TCTAGA GCTCTTC tttttcacctctgcctaatca

[0023] P2FULL: CCGG TCTAGA GCTCTTC aaaaagttgcatggtgctgg

[0024] The reaction system is:

[0025] 10×PCR buffer 5μl

[0026] dNTP mix (10mM) 1μl

[0027] Primer 1 (25pM) 1μl

[0028] Primer 2 (25pM) 1μl

[0029] Pfu enzyme (2U / μl) 1μl

[0030] HBVDNA 10μl

[0031] Add ddH2O to 50μl

[0032] The reaction system was 95°C for 5 minutes, 95°C for 40s→58°C for 30s→72°C for 180s, cycled 35 times, and finally kept at 72°C for 10 minutes.

[0033] After gel electrophoresis, the product was purified with a 3.2kb band, reacted with Taq enzyme + dATP at 72°C for 15 minutes, added A at the end, mi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method of HBV (Hepatitis B Virus) isolating strain replicating-form plasmid, comprising the following steps of: 1, extraction of HBV full-length genome, PCR (Polymerase Chain Reaction) amplification and clone construction; 2, construction of a recombinant transition vector; 3, enzyme cutting and dephosphorylation of the recombinant transition vector; and 4, construction of replicating-form plasmid, wherein the recombinant transition vector is synchronously and directionally connected by three connection segments, two reverse BspQI enzyme cutting sites are formed between two inserted HBV segments, and the clone of the HBV full-length genome and the bacterial colony cultivation and amplification of the replicating-form plasmid are carried out by an SOC culture medium. The invention applies a novel full-length genome clone vector, improves the enzyme cutting solution and adopts a novel bacterial colony culture medium. The invention has the advantages of simple performance, high efficiency and stability, can be applied to the comprehensive phenotype research on a China HBV clinic isolating strain whole genome and has very important application value.

Description

technical field [0001] The invention relates to the technical field of in vitro phenotype research of hepatitis B virus, in particular to the construction of a replication-type plasmid of a hepatitis B virus isolate. Background technique [0002] In my country, hepatitis B virus (HBV) infection is the main cause of chronic hepatitis, liver cirrhosis and hepatocellular carcinoma. HBV replication is achieved through the process of reverse transcription, during which mutations are most likely to occur. In recent years, with the application and popularization of antiviral drugs and vaccines, the problems of drug resistance and immune escape due to virus mutation have attracted more and more attention. Phenotypic research on clinical isolates of HBV variants is an important means of HBV variation research. [0003] Cell models are the most widely used in the in vitro phenotype study of HBV variants. Cell model research methods include vector-mediated and non-vector-mediated tr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12R1/93
Inventor 张欣欣于德敏张东华陈立邓俊姜节洪
Owner RUIJIN HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products