Recombinant human papilloma virus type 33 L1 protein and its purpose

A protein and combination technology, applied in the direction of viruses, viral peptides, antiviral agents, etc., can solve the problems of difficult target proteins, many types of hybrid proteins, loss of natural conformation, etc.

Active Publication Date: 2014-07-23
BEIJING HEALTH GUARD BIOTECH
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because most of the HPV L1 protein expressed by E. coli loses its natural conformation, it cannot produce protective antibodies against HPV.
Or although the above protein can be purified by inclusion bodies, renaturation and other steps can also obtain HPV VLP, but the loss of protein is large during the renaturation process, and the yield is low, so it is difficult to apply in large-scale production.
Although the full-length sequence protein of HPV L1 can also be solublely expressed in the correct conformation in Escherichia coli and dissolved in the lysed supernatant of the bacteria, the expression level is low, and there are many types and large amounts of foreign proteins in the supernatant. It is quite difficult to purify the target protein, and it is still not applicable to large-scale production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant human papilloma virus type 33 L1 protein and its purpose
  • Recombinant human papilloma virus type 33 L1 protein and its purpose
  • Recombinant human papilloma virus type 33 L1 protein and its purpose

Examples

Experimental program
Comparison scheme
Effect test

Embodiment l

[0072] Embodiment 1: have the construction of the engineering bacterium of HPV33 L1 sequence 2

[0073] 1、 The full-length HPV33 L1 gene was synthesized by GENEWIZ Biotechnology Co., Ltd. (GENEWIZ). Nucleotide sequence SEQ ID NO: 1, which is derived from GeneBank, the sequence number is GenBank: M14119.1.

[0074] 2. A template for PCR reaction containing the gene fragment of SEQ ID NO:1. With the forward primer sequence: 5'- CGCGGA TCCGGA GAAAAGGAAGACCCTTAGGT -3'; a restriction endonuclease AccIII site was introduced at the 5' end of the H4 structure, and the sequence of the AccIII site was TCCGGA. The downstream contains the XhoI endonuclease site, the reverse primer sequence: 5'-GCTCTCCTCGAG TTA TTTAGGTTTT GCTTTAAGAC C -3', the 5' end introduces the restriction endonuclease XhoI site, and the XhoI site sequence is CTCGAG. HPV33B was amplified by PCR reaction.

[0075] 3. A template containing the gene fragment of SEQ ID NO: 1 for PCR reaction. To contain the introduce...

Embodiment 2

[0080] Embodiment 2: Construction of engineering bacteria with HPV33 L1 sequence 4

[0081] 1. The target gene fragment of the full-length HPV33 L1 gene was purchased from the clinical cell sample waste containing wild-type HPV33 virus from the Gynecology Clinic of Beijing Anzhen Hospital. Nucleotide The sequence is SEQ ID NO: 3 (GenBank: FN870689.1).

[0082] 2. A template containing the gene fragment of SEQ ID NO: 3 for PCR reaction. With the forward primer sequence: 5'- CGCGGATCCGGA GAAAAGGAAGACCCTTAGGT -3'; a restriction endonuclease AccIII site was introduced at the 5' end of the H4 structure, and the sequence of the AccIII site was TCCGGA. The downstream contains the XhoI endonuclease site, the reverse primer sequence: 5'-GCTCTCCTCGAG TTA TGTGCGGGTG GATGTGGGGG C -3', its 5' end introduces the restriction endonuclease XhoI site, and the XhoI site sequence is CTCGAG. After PCR reaction, HPV33B was amplified.

[0083] 3. A template containing the gene fragment of SE...

Embodiment 3

[0088] Embodiment 3: Construction of engineering bacteria with HPV33 L1 sequence 6

[0089] 1、 The full-length HPV33 L1 gene was synthesized by GENEWIZ Biotechnology Co., Ltd. (GENEWIZ). Nucleotide sequence SEQ ID NO: 5, which is derived from GeneBank, the sequence number is GenBank: FN870694.1.

[0090] 2. A template containing the gene fragment of SEQ ID NO: 3 for PCR reaction. Forward primer sequence: 5'- CGCGGATCCGGA GAAAAGGAAGACCCCTTAGGT-3'; a restriction endonuclease AccIII site was introduced at the 5' end of the H4 structure, and the sequence of the AccIII site was TCCGGA. The downstream contains the XhoI endonuclease site, the reverse primer sequence: 5'-GCTCTCCTCGAG TTA TGTGCGGGTG GATGTGGGGG C -3', its 5' end introduces the restriction endonuclease XhoI site, and the XhoI site sequence is CTCGAG. PCR reaction, amplified to obtain HPV33B.

[0091]3. A template containing the gene fragment of SEQ ID NO: 3 for PCR reaction. To contain the introduced restriction en...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Diameteraaaaaaaaaa
The average particle sizeaaaaaaaaaa
Login to View More

Abstract

The invention provides a polynucleotides gene fragment of recombinant human papilloma virus type 33 L1 protein, a carrier containing the gene fragment, a host cell containing the comprise, and a HPV33L1 protein pentamer expressed by the gene fragment and an anti-HPV type 33 infection vaccine composed of the pentamer.

Description

technical field [0001] The present invention relates to the prevention and / or treatment of human papilloma virus infection. More specifically, the present invention relates to a recombinant human papillomavirus type 33 L1 protein, and a pentamer composed of it, a vaccine containing the protein and its role in preventing HPV33 virus infection, especially in preventing HPV33 type Use in cervical cancer disease caused by viral infection. [0002] Background technique [0003] Human Papillomavirus (HPV) is a DNA virus transmitted through close contact. In human tissues, HPV mainly infects skin and mucous membrane tissues. HPV DNA is divided into three categories according to the carcinogenicity of the virus: (1) Low-risk HPVs, including HPV6, 11, 40, 42, 43, 44, 54, 61, 70.72.51, mainly cause benign exophytic warts, cervical Intraepithelial neoplasm (cervical intraepithelial neoplasm, CIN) (2) high-risk HPV, including HPV 16, 18, 31, 33, 35, 39, 43, 51, 52, 56, 58, 59, 68, 7...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/025C12N15/37C12N15/70C12N15/81C12N1/21C12N1/19A61K39/12A61P31/20A61P35/00
CPCA61K39/00C07K14/005C12N2710/20022C12N2710/20033C12N2710/20034
Inventor刘永江陈小江陈林盖大海许铮曹科陈建平潘勇昭银飞阮芳勇
OwnerBEIJING HEALTH GUARD BIOTECH