Recombinant pichia pastoris bacterial strain for co-expressing inulin excision enzyme and incision enzyme as well as construction method and application of bacterial strain

A technology of exo-inulinase and Pichia pastoris, which is applied in the field of genetic engineering and fermentation engineering, can solve the problems of unsuitable industrial application, difficulty in large-scale cultivation, low enzyme activity, etc., achieve good genetic stability, and is fully feasible The effect of improving the efficiency and enzyme digestion efficiency

Active Publication Date: 2014-07-30
SHANDONG UNIV
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Extensive studies have shown that unmodified inulinase-producing microorganisms generally have low enzyme activity and low yield, making it difficult to cultivate on a large scale and unable to meet industrial applications.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant pichia pastoris bacterial strain for co-expressing inulin excision enzyme and incision enzyme as well as construction method and application of bacterial strain
  • Recombinant pichia pastoris bacterial strain for co-expressing inulin excision enzyme and incision enzyme as well as construction method and application of bacterial strain
  • Recombinant pichia pastoris bacterial strain for co-expressing inulin excision enzyme and incision enzyme as well as construction method and application of bacterial strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Construction of recombinant Pichia pastoris GS115-INU1 expressing exo-inulinase INU1

[0038] 1. Construction of recombinant plasmid pPIC9-INU1

[0039] 1.1 Genome extraction

[0040] The genome of Kluyveromyces marxianus CGMCC2.1440 was extracted with a yeast genomic DNA extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.). For specific preparation methods, refer to the operation manual of the kit.

[0041] 1.2 Cloning of gene INU1

[0042] Use the genome extracted in 1.1 as a template for the PCR reaction, and design a pair of primers based on the known exinulinase gene sequence on NCBI:

[0043] INU1-XhoI upstream:

[0044] GCCCG CTCGAG AAAAGAGAGGCTGAAGCTAGAGATGGTGACAGCAAGGCC

[0045] (The underlined part is the XhoI restriction site);

[0046] Downstream of INU1-AvrII:

[0047] GCCCG CCTAGG ATGGTGGTGATGGTGGTGAACGAACGTTACCCAATTTAACG

[0048] (the underlined part is the AvrII restriction site),

[0049] A PCR reactio...

Embodiment 2

[0084] Example 2 Construction of recombinant Pichia pastoris GS115-INU1-INU2 expressing exinulinase INU1

[0085] 1. Construction of recombinant plasmid pPIC9K-INU2

[0086] 1.1 Genome extraction

[0087]The genome of Aspergillus ficuum CGMCC3.4322 was extracted with Biospin Fungus Genomic DNA Extraction Kit (Bioer Technology co., Ltd.). For the specific preparation method, refer to the operation manual of the kit.

[0088] 1.2 Cloning of gene INU2

[0089] Use the genome extracted in 1.1 as a template for the PCR reaction, and design a pair of primers based on the known endinulinase gene sequence on NCBI:

[0090] INU2-EcoR I upstream:

[0091] ACGC GAATTC CAGTCTAATGATTACCGTCCTT (the underlined part is the EcoR I restriction site);

[0092] Downstream of INU2-Not I:

[0093] ATA GCGGCCGC TCATTCAAGTGA AACACTCC (the underlined part is the Not I restriction site),

[0094] A PCR reaction was performed to clone INU2. PCR amplification conditions: pre-denaturation at 94...

Embodiment 3

[0127] Embodiment 3 Utilize the method for expressing inulinase in large quantities by high-density fermentation of Pichia pastoris (Pichia pastoris) GS115-INU1-INU2 strain of the present invention

[0128] The main instruments used in this method are:

[0129] Fermenter Labfors5 (3.6L): purchased from Iverson Biotechnology Co., Ltd.

[0130] The specific plan is as follows:

[0131] Inoculate the transformant GS115-INU1-INU2 into 100ml of YPD medium, and shake the flask to culture to bacterial concentration OD 600 The value is 4-6, and the inoculation amount of 10% by volume is received in a 3L fermenter equipped with 1.2LBSM basic salt medium, and fed-batch culture is carried out. During the fermentation process, ammonia water is added to adjust the pH value, the ventilation volume is maintained at 1-3vvm, and the rotation speed is 400-900r / min.

[0132] Bacteria growth stage: temperature is set at 30°C, pH is 4.5, and dissolved oxygen is kept above 10%. After 22-24 hours...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant pichia pastoris bacterial strain for co-expressing inulin excision enzyme and incision enzyme. The bacterial strain is named as pichia pastoris GS115-1NU1-INU2, which has been collected in China General Microbiological Culture Collection Center on April 16, 2014, with the collection number of CGMCC No.9050. The bacterial strain disclosed by the invention is obtained by expressing plasmids pPIC9 and pPIC9K, integrating an inulin excision enzyme gene and an inulin incision enzyme gene on a pichia pastoris GS115 genome, and screening. The bacterial strain is induced by methanol to ferment, so that two inulin enzymes can be expressed at the same time; enzyme activity of the inulin enzyme prepared by fermentation can achieve 4211.8U / ml; moreover, reaction time for producing monosaccharide by hydrolyzing inulin is short, and conversation efficiency is high, so that production of high fructose syrup by an enzyme method has sufficient feasibility; a conventional production method of high fructose syrup is replaced, and therefore, the recombinant pichia pastoris bacterial strain has a huge application value.

Description

technical field [0001] The invention belongs to the field of genetic engineering and fermentation engineering, and relates to a recombinant Pichia pastoris strain co-expressing exo-inulinase and endo-inuclease at a high level, its construction method and application. Background technique [0002] Inulin is a chain-like macromolecule composed of D-fructofuranose molecules connected by 2,1-glycosidic bonds of β powder, and often contains a glucose group at the end. Inulinase is a hydrolase that catalyzes the hydrolysis of β-2,1-fructofuranosidic bonds in inulin. According to its mode of action on the substrate, it can be divided into two categories: one is exoinulinase (exoinulinase), which can cut off a fructose unit from the inulin powder end one by one, and the product is fructose and a small amount of glucose. The other is endoinulinase, which randomly cuts a certain β-2,1-glucosidic bond from within the inulin molecule, and the hydrolyzed product is oligosaccharide, whic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/19C12N15/81C12N9/24C12R1/84
Inventor林建强林胜强白杨刘国丽林建群周茜刘翠
OwnerSHANDONG UNIV