A high-affinity CTLA4-IG fusion protein mutant

A fusion protein, mutant technology, applied in the field of genetic engineering products, can solve the problem of long retention time and other problems

Active Publication Date: 2014-10-29
SHANGHAI NAT ENG RES CENT OF ANTIBODY MEDICINE
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The half-life of CTLA4-Ig fusion protein is close to that of antibody molecules, and the activity time is relatively long

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A high-affinity CTLA4-IG fusion protein mutant
  • A high-affinity CTLA4-IG fusion protein mutant
  • A high-affinity CTLA4-IG fusion protein mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1. Cloning of CTLA-4 extramembrane region gene and Fc region gene

[0033] Lymphocytes from healthy people were separated with lymphocyte separation medium, total RNA was extracted with Trizol reagent (product of Invitrogen Company), primers were designed to amplify the CTLA-4 extramembrane region gene (GeneID: 1493), and primers FC sense: GCCCAGATTCTGATCAGGAGCCCAAATCTTCTGAC and FC reverse Sense: GAATTCTCATTTACCCGGAGACAGG amplifies the antibody Fc region. All PCR reactions were hot-started, and the reaction conditions were: 94°C for 45 seconds, 60°C for 45 seconds, 72°C for 1 minute and 10 seconds, 30 cycles; 72°C for 10 minutes. The PCR product was purified and recovered by agarose gel electrophoresis and cloned into the pGEM-T (promega company) vector. After sequencing verification, it was confirmed that the correct clone was obtained. SEQ ID NO: 1 and SEQ ID NO: 2 show the nucleotide and amino acid sequences of the extramembrane region of CTLA-4. SEQ ID NO:...

Embodiment 2

[0034] The expression vector construction of embodiment 2.CTLA4-Ig fusion protein

[0035] Design primers to perform overlapPCR on the synthesized signal peptide sequence SEQ ID NO: 5 and the cloned CTLA-4 extramembrane gene fragment, perform overlapPCR on the sequenced correct fragment and antibody IgG1 Fc, and install pGEM-T vector for sequencing. Select the clone with correct sequencing and cut the CTLA4-Ig fusion protein gene with HindIII and EcoR I, purify and recover through agarose gel electrophoresis, and use HindIII and EcoR I to digest the plasmid pcDNA3. The connection was carried out to construct the eukaryotic expression vector pcDNA3.1(+), denoted as pcDNA3.1(+)(CTLA4-Ig).

Embodiment 3

[0036] Example 3. Stable expression and purification of fusion protein

[0037] Inoculate 3×10 in a 3.5cm tissue culture dish 5 CHO-K1 cells (ATCC CRL-9618), transfected when the cells were cultured to 90%-95% confluence: get 10 μg of plasmid (plasmid pcDNA3.1 (+) (CTLA4-Ig) 10 μg and 20 μl of Lipofectamine2000Reagent (product of Invitrogen Company) respectively Dissolve in 500μl serum-free DMEM medium, let stand at room temperature for 5 minutes, mix the above two liquids, incubate at room temperature for 20 minutes to form DNA-liposome complexes, and replace the culture dish with 3ml serum-free DMEM medium serum-containing medium, and then add the formed DNA-liposome complexes to the plate, CO 2 After culturing in the incubator for 4 hours, add 2ml of DMEM complete medium containing 10% serum and place in CO 2 Continue to grow in the incubator. After 24 hours of transfection, the cells were replaced with selection medium containing 600 μg / ml G418 to screen for resistant c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses cytotoxic T lymphocyte associate antigen-4 immune globulin (CTLA4-Ig) fusion protein mutants with high affinity, and application thereof to the preparation of medicaments for treating immunological rejection or autoimmune diseases. The mutants comprise amino acid substitutions on any one or more amino acid sites in a CTLA-4 ectodomain. Compared with Abatacept, the mutants have higher affinity and can more effectively block up activation of a costimulatory factor to T cells.

Description

technical field [0001] The invention relates to the field of genetic engineering products, more specifically, the invention discloses a CTLA4-Ig fusion protein mutant with high affinity and its use in preparing medicines for treating immune rejection or autoimmune diseases. Background technique [0002] CTLA-4, Cytotoxic T Lymphocyte associate Antigen-4 (also known as CD152), is one of the marker molecules expressed on the surface of activated T cells. Studies have shown that this molecule is a negative regulatory factor that maintains the stability of T cells in vivo, has the function of inhibiting the proliferation of activated T cells, and constitutes a pair of very important immune regulatory factors with CD28. At present, it has been extensively studied as an immunosuppressive receptor, and it may be used clinically as an agent for inhibiting immune rejection. [0003] Molecules on the surface of T cells and antigen-presenting cells that participate in co-stimulation a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K19/00A61K47/42
Inventor郭亚军李博华王皓侯盛赵磊
OwnerSHANGHAI NAT ENG RES CENT OF ANTIBODY MEDICINE