Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular marker for assisted breeding of Xanthomonas oryzae resistance gene Xa7 and application thereof

A technology of bacterial blight resistance and molecular markers, which is applied in the determination/testing of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem of single resistance, poor persistence, and poor resistance to bacterial blight and other issues, to achieve the effects of good stability, improved breeding efficiency, and low cost

Inactive Publication Date: 2011-08-10
ZHEJIANG NORMAL UNIVERSITY
View PDF2 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the hybrid rice planted in a large area in China has poor resistance to bacterial blight, mainly because most of the parental sterile lines do not carry bacterial blight resistance genes, while most of the resistance genes carried by restorer lines are derived from Xa4. Therefore, the resistance is single and the durability is not good

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for assisted breeding of Xanthomonas oryzae resistance gene Xa7 and application thereof
  • Molecular marker for assisted breeding of Xanthomonas oryzae resistance gene Xa7 and application thereof
  • Molecular marker for assisted breeding of Xanthomonas oryzae resistance gene Xa7 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 2

[0037] It is known that the rice varieties "Zhenshan 97, Longtefu, and Xieteqing" do not contain the Xa7 gene. These three rice varieties were backcrossed with the bacterial blight-resistant rice variety IRBB7 several times, and the molecular markers were used to assist Sexually selected, the Xa7 gene was successfully transferred to this variety (such as Figure 4 shown), significantly enhanced its resistance to bacterial blight. Taking Zhenshan 97, one of the varieties, as an example, the specific process is as follows:

[0038] The rice variety IRBB7 containing the Xa7 gene was used as the male parent and crossed with the female parent variety Zhenshan 97 to obtain F 1 Progeny and the recurrent parent Zhenshan 97 were backcrossed multiple times, and the Xa7 gene was transferred to Zhenshan 97; because the offspring of the backcross would segregate, only a part of the individuals in the population carried the Xa7 gene, and the plants containing the Xa7 gene must be selected ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker dCAPS (Derived Cleaved Amplified Polymorphic Sequences) for assisted breeding of an Xanthomonas oryzae resistance gene Xa7. A nucleotide sequence of the molecular marker is SEQ ID NO. 1. Primers of the molecular marker dCAPS comprise the following primer pairs, wherein the nucleotide sequence is 5'-3', a forward primer is 5'GCGGTGGTCGTGTGTTCTTCG 3', and a reverse primer is 5'TCCGGCACAGCCGCCGCCTC 3'. The invention also discloses a purpose of the molecular marker dCAPS of bacterial leaf blight resistance gene Xa7 for assisted breeding, the dCAPS molecular marker is used for assisted selection breeding of the gene Xa7or cloning the gene Xa7.

Description

technical field [0001] The invention relates to the development of a molecular marker of rice disease-resistant gene Xa7 and its application in breeding, belonging to the field of crop genetics and breeding. Background technique [0002] Rice bacterial blight (Xanthomonas oryzae pv. Oryzae) is one of the most serious bacterial diseases in rice production in the world. Together with rice blast and sheath blight, it is called the "three major diseases" of rice. At present, the hybrid rice planted in a large area in China has poor resistance to bacterial blight, mainly because most of the parental sterile lines do not carry bacterial blight resistance genes, while most of the resistance genes carried by restorer lines are derived from Xa4. Therefore, the resistance is single and the durability is not good. Improving the resistance of hybrid rice to bacterial blight by using new disease resistance genes is an urgent problem to be solved in breeding. So far, more than 30 bacter...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor 马伯军陈析丰顾志敏郑茜茜
Owner ZHEJIANG NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More