Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

223 results about "Xanthomonas oryzae" patented technology

Xanthomonas oryzae is a species of Proteobacteria. The major host of the bacterium is rice. The species contains two pathovars which are not European: Xanthomonas oryzae pv. oryzae and Xanthomonas oryzae pv. oryzicola.

Bacillus subtilis and application thereof

The invention relates to a Bacillus subtilis T-500. The Bacillus subtilis T-500 has been preserved in CGMCC (China General Microbiological Culture Collection), and the preservation number is CGMCC NO:6058. The Bacillus subtilis T-500 can be used as a biological pesticide for preventing and treating multiple plant diseases, and can also be used as a biological fertilizer for promoting the yield increase of crops. The Bacillus subtilis T-500 has higher antibacterial activity on Magnaporthe oryzae, Pellicularia sasakii, Xanthomonas oryzae, Ustilaginoidea virens, Xanthomonas oryzae pv. oryzicola, Fusarium graminearum, Aspergillus flavus, Aspergillus niger and other pathogenic bacteria, and has better prevention and control effects on diseases caused by the pathogenic bacteria. The Bacillus subtilis T-500 can prevent and treat rice leaf diseases when being diluted 200-500 times on the leaves of rice, can prevent and treat bakanae diseases of rice after seed soaking, and can prevent and treat soil-borne diseases of vegetables and the like after root irrigation.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES

Bacillus subtilis NB12, as well as culture method and application thereof

The invention discloses bacillus subtilis NB12, as well as a culture method and an application thereof. The strain with a preservation number of CGMCC No.5383 is preserved in China General Microbiological Culture Collection Center on October 24, 2011. Researches prove that: the strain has strong inhibition effects to rhizoctonia solani, colletotrichum musae, pyricularia grisea, fusarium graminearum, fusarium oxysporum f.sp.cubense, peronophythora litchi, ustilago scitaminea, fulvia fulva, xanthomonas oryzae and xanthomonas oryzae pv.oryzicola, is a broad-spectrum antagonistic strain, can be used for prevention and control of various plant diseases, has a particular good prevention and control effect to the rice sheath blight and damping off in seedling phase of cowpea, has the advantages of harmlessness to human and livestock, greenness and safety, good environment compatibility, difficult resistance generation and the like, can be used for commercial development, and has a wide application prospect.
Owner:SOUTH CHINA AGRI UNIV

Burkholderia cepacia SD7 and culturing method and application thereof

The invention discloses burkholderia cepacia SD7 and a culturing method and application thereof. The bacterial strain is preserved in China General Microbiological Culture Collection Center on October 24th, 2001, and the preservation number is CGMCC No.5384. Through research, the bacterial strain has strong inhibiting effect on rhizoctonia solani, collectotrichum musae, pyricularia grisea, gibberella zeae, fusarium oxysporum f. sp. cubense, peronophythora litchi, ustiago scitamimea syd, fulvia fulva, xanthomonas oryzaepv.oryzae, xanthomonas oryzae pv. Oryzicola, and the like, is broad-spectrum antagonistic bacteria, can be used for preventing and treating a plurality of plant diseases, particularly has better preventing and treating effect for banana fruit anthracnose and rice sheath blight, has the advantages of harmlessness to person and animals, environmental protection and safety, good environmental compatibility, and difficulty in becoming resistant, is good for business development, and has broad application prospect.
Owner:SOUTH CHINA AGRI UNIV

Bacillus velezensis CSQXDZ26 strain and application thereof

The invention discloses a bacillus velezensis strain CSQXDZ26, which is bacillus velezensis (Bacillus velezensis) with the preservation number of CGMCC NO. 17935. The bacillus velezensis CSQXDZ26 hasremarkable antagonistic activity on bacterial plant diseases such as Xanthomonas oryzae pv. Oryzae, Xanthomonas oryzae pv. oryzicola, and xanthomonasaxonopodis pv. glycines AND THE LIKE; meanwhile, the bacillus velezensis CSQXDZ26 also has antibacterial activity on fungal plant diseases such as dithiorella gregaria, Fusarium graminearum, Fusarium oxysporum f.sp.Cucumerinum, Fusarium oxysporum f.sp. momordicae, Alternaria solani or Alternaria alternate, and also has excellent inhibition effect on common food spoilage bacteria such as bacillus subtilis, proteusbacillus vulgaris and staphylococcus aureus.
Owner:ZHEJIANG NORMAL UNIVERSITY +1

Streptomyces katrae NB20, as well as culture method and application thereof

The invention discloses streptomyces katrae NB 20, as well as a culture method and an application thereof. The strain with a preservation number of CGMCC No.5382 is preserved in China General Microbiological Culture Collection Center on October 24, 2011. Researches prove that: the strain has strong inhibition effects to colletotrichum musae, pyricularia grisea, fusarium graminearum, fusarium oxysporum f.sp.cubense, peronophythora litchi, ustilago scitaminea, fulvia fulva, xanthomonas oryzae and xanthomonas oryzae pv.oryzicola, is a broad-spectrum antagonistic strain, can be used for prevention and control of various plant diseases, has a particular good prevention and control effect to the colletotrichum musae, has the advantages of harmlessness to human and livestock, greenness and safety, good environment compatibility, difficult resistance generation and the like, and has a wide application prospect.
Owner:SOUTH CHINA AGRI UNIV

Rice disease resistance relevant gene OsWRKY45-2 and application thereof in improving rice disease resistance

The invention relates to the technical field of plant genetic engineering, in particular relates to isolating clone and functional verification of a DAN fragment containing a gene OsWRKY45-2 related to rice disease resistance. The gene OsWRKY45-2 codes WRKY proteinoids and can endow rice with resistance to the diseases caused by bacterial pathogenic bacteria, namely the leaf blight bacteria (Xanthomonas oryzae pv.oryzae) and fungal pathogenic bacteria, namely the rice blast bacteria (Magnaporthe grisea). The fragment and the exogenous regulatory sequence thereof are directly transferred into rice, thus the resistance capability of transgenic rice with over-expression OsWRKY45-2 against bacterial blight in and rice blast is improved remarkably.
Owner:HUAZHONG AGRI UNIV

Pyridine salt compound containing 1,3,4-oxadiazolyl (thiadiazolyl) and preparation method and application thereof

The invention disclose a pyridine salt compound containing 1,3,4-oxadiazolyl (thiadiazolyl) and a preparation method and application thereof. The compound is of the structure shown in the general formula (I). Based on the 1,3,4- oxadiazole (thiadiazole) thioether (sulfoxide or sulfone) compound, a pyridine base capable of improving the biological activity of the target compound is introduced into the system, and a series of 1,3,4- oxadiazole (thiadiazole) oxygen ether, thioether, sulfoxide or sulfone amphipathic molecules containing pyridine salt are synthesized. It is found that the compound has the good restraining effect on pathogenic bacteria and fungi such as Xanthomonas oryzae pv. oryzae, Ralstonia solanacearum, Xanthomonas axonopodis pv. citri, Gibberella zeae, Phytophythora infestans, Rhizoctonia solani, Borrytis cinerea, Fusarium oxysporum and Phytophythora infestans, and provides an important scientific foundation for new pesticide research, development and creation.
Owner:GUIZHOU UNIV

Burkholderia cepacia, and cultivation method and application thereof

The invention relates to burkholderia cepacia, and a cultivation method and an application thereof, and belongs to the field of plant protection (microbial pesticide). A preservation number of the burkholderia cepacia is CGCC No. 5384. According to the cultivation method, fermentation conditions are as follows: an LB culture medium is used; liquid volume is 50 mL; 1 mL of 2-day old seed strain is added; and the strain is cultured for 20-24 h at a temperature of 25-30 DEG C and at a rotation speed being 200 r / min. The burkholderia cepacia has significant inhibition effects for rhizoctonia solani, pyricularia oryzae, collectotrichum musae, fusarium oxysporum f. sp. cubense, gibberella zeae, peronophythora litchi, ceratocystis adiposum, fulvia fulva, xanthomonas oryzae pv. oryzae, xanthomonas oryzae pv. oryzicola and the like, can be used for biological control of plant pathogenic bacteria, has the advantages of low toxicity, easy degradation, environment friendliness and the like, and has wide application prospects.
Owner:西安西诺农化有限责任公司

Myricetin derivative containing amide thioether thiadiazole, and preparation method and application of same

The invention discloses a myricetin derivative containing amide thioether thiadiazole, of which a general formula is represented as follows, wherein R is hydrocarbyl groups, phenyl groups, substituted phenyl groups, heteroaromatic ring groups or substituted heteroaromatic ring groups. The compound has high treatment and prevention effect against tobacco mosaic virus (TMV), has high anti-plant virus activity and can be used for preparing anti-plant virus pesticides. The compound has high inhibition activity on Xanthomonas axonopodis and Xanthomonas oryzae and can be used for preparing agricultural bactericides.
Owner:GUIZHOU UNIV

Bidirectional burkholderia as well as culture method and application thereof

The invention relates to bidirectional burkholderia as well as a culture method and an application thereof and belongs to the field of plant protection (microbial pesticide). The preservation number of the bidirectional burkholderia is CCTCC NO: M2013145. The culture method of the bidirectional burkholderia comprises the following steps: adding 1ml of 2-day-aged seed bacterial strain to an LB (Lysogeny broth) culture medium with the liquid loading of 50ml under a fermentation condition, and culturing for 20-24 hours at the temperature of 25-30 DEG C at the rate of 200r / min. The bidirectional burkholderia has a remarkable inhibition effect on rice sheath blight disease, rice blast, colletotrichum musae, oxysporum, fusarium asiaticum, peronophythora litchi, sugarcane alternaria tenuis, cladosporium fulvum, xanthomonas oryzae, bacterial leaf steak and the like, can be used for the biological prevention and control of plant pathogenic bacteria, has the advantages of low toxicity, easy degradation, environmental friendliness and the like and has a bright application prospect.
Owner:西安西诺农化有限责任公司

Padlock probe for detecting Xanthomonas oryzae pv. oryzae and anthomonas oryzae pv.oryzicola and multiple detection method

The invention provides a padlock probe for detecting Xanthomonas oryzae pv. oryzae and Xanthomonas oryzae pv.oryzicola and a multiple detection method, belonging to the fields of disease prevention and treatment of crops and quarantine of plants. A padlock probe sequence P-x.o.o for detecting the Xanthomonas oryzae pv. oryzae is GGAGCTATATGCCGTGCTGTGTGGAGTACTCGACCGTTAGCAGCATGACCGAGATGTACCGCTATCGTGAATCGCCTACAATTCTGTCCCCCAAGTTGCCTC. A padlock probe sequence P-x.o.oc for detecting the Xanthomonas oryzae pv.oryzicola is CCACACAACACGGCATATCGCTCCAAGGCTCGACCGTTAGCAGCATGACCGAGATGTACCGCTATCGTGCGGCATACGTTCGTCAAATGGTGGCTTTGTACC. The multiple detection method is combined with a Macroaary technique on the basis of the probe to simultaneously detect the Xanthomonas oryzae pv. oryzae and the Xanthomonas oryzae pv.oryzicola and has strong specialty, sensitivity and stability; and a rapid, sensitive and special method is provided for detecting the Xanthomonas oryzae pv. oryzae and the Xanthomonas oryzae pv.oryzicola. The figure shows the result of combining the padlock probe and the Macroaary technique to simultaneously detect the Xanthomonas oryzae pv. oryzae and the Xanthomonas oryzae pv.oryzicola.
Owner:NANJING AGRICULTURAL UNIVERSITY

Oryza officinalis anti-Xanthomonas oryzae major gene Xa3/Xa26-2 and application for improving disease resistance of rice thereof

The invention relates to the technical field of the plant genetic engineering, in particular to the isolation and cloning and functional verification of the DNA fragment of oryza officinalis anti-Xanthomonas oryzae major gene Xa3 / Xa26-2. The Xa3 / Xa26-2 gene is used to code the leucine-rich protein kinase protein. The Xa3 / Xa26-2 gene ensures that rice can resist diseases caused by bacterial pathogen-Xanthomonas oryzae pv. oryzae. The DNA fragment and the regulatory sequence thereof are directly transferred in rice, and the resistance capability to Xanthomonas oryzae of the transgenic rice carrying Xa3 / Xa26-2 is significantly enhanced.
Owner:HUAZHONG AGRI UNIV

Molecular marker for assisted breeding of Xanthomonas oryzae resistance gene Xa7 and application thereof

The invention discloses a molecular marker dCAPS (Derived Cleaved Amplified Polymorphic Sequences) for assisted breeding of an Xanthomonas oryzae resistance gene Xa7. A nucleotide sequence of the molecular marker is SEQ ID NO. 1. Primers of the molecular marker dCAPS comprise the following primer pairs, wherein the nucleotide sequence is 5'-3', a forward primer is 5'GCGGTGGTCGTGTGTTCTTCG 3', and a reverse primer is 5'TCCGGCACAGCCGCCGCCTC 3'. The invention also discloses a purpose of the molecular marker dCAPS of bacterial leaf blight resistance gene Xa7 for assisted breeding, the dCAPS molecular marker is used for assisted selection breeding of the gene Xa7or cloning the gene Xa7.
Owner:ZHEJIANG NORMAL UNIVERSITY

Biocontrol Bacillus velezensis SF259 and application thereof

ActiveCN111154688AHas antagonistic activityHas antagonistic effectBiocideBacteriaBiotechnologyConiella castaneicola
The invention relates to biocontrol Bacillus velezensis SF259 and application thereof. The Bacillus velezensis strain is collected in the China Center for Type Culture Collection (CCTCC) on September20, 2019, with the collection name of Bacillus velezensis SF259 and the collection number of CCTCCM 2019735. The Bacillus velezensis has a significant inhibition effect on xanthomonas oryzae pv. oryzae (Xoo), also shows broad-spectrum bacteriostatic activity for xanthomonas oryzae pv. oryzicola (Xoc), X. campestris pv. musacearum, X. axonopodis pv. vignicola, X. campestris pv. malvacearum, botrytis cinerea and magnaporthe oryzae, and has important biocontrol application prospects.
Owner:SHANGHAI JIAO TONG UNIV

Rice disease resistance related gene OsWRKY45-1 and application thereof in improvement on rice disease resistance

The invention relates to the technical field of plant gene engineering, in particular to the isolation cloning and function verification of a DNA fragment containing a rice disease resistance related gene OsWRKY45-1. A nucleotide sequence of the OsWRKY45-1 gene and an amino acid sequence encoded by the gene are shown in SEQ ID NO: 1. Genetically transformed rice of which the expression level of the OsWRKY45-1 gene is remarkably reduced apparently strengthens the resistance on xanthomonas oryzae pv. oryzae and xanthomonas oryzae pv.oryzicola, which proves that the OsWRKY45-1 gene is a negative regulatory factor in reactions of resisting bacterial blight and bacterial stripe of rice, and the disease resistance of the rice can be improved by inhibiting the expression of the OsWRKY45-1 gene.
Owner:HUAZHONG AGRI UNIV

SigRNAs specifically shearing rice xal3 gene promoter using CRISPR/Cas9 system and its application

The invention provides a group of sgRNAs specifically shearing a rice xal3 gene promoter by using a CRISPR / Cas9 system and an application thereof, which belong to the technical field of plant geneticengineering. The sgRNA of the present invention comprises g1 RNA and g2 RNA; a nucleotide sequence of the g1 RNA is shown as SEQ ID NO. 1; a nucleotide sequence of the g2RNA is shown as SEQ ID NO. 2.A recombinant expression vector constructed by the sgRNA combination provided is used for transfection of a rice plant, a 149nt promoter region of the xal3 gene can be specifically deleted, so that the xal3 gene in rice loses the ability to be induced and expressed by Xanthomonas oryzae, and the transgenic rice lacking the promoter fragment exhibits resistance to Xanthomonas oryzae. In addition, the method provided by the present invention does not affect other traits of transgenic rice, and the transgenic rice has good fertility.
Owner:HUAZHONG AGRI UNIV

Bactericidal composition containing tetramycin and zhongshengmycin

The invention provides a bactericidal composition containing tetramycin and zhongshengmycin. The bactericidal composition comprises compounded effective components consisting of tetramycin and zhongshengmycin, with the balance being auxiliary components. The mass ratio of tetramycin to zhongshengmycin in the composition is 1-50 50-1, and the mass fraction of tetramycin and zhongshengmycin in a preparation is 1 to 80%, with the balance being auxiliary components which are allowed to use and admitted in pesticides; dosage forms of the composition comprise missible oil, a suspending agent, a wettable powder, a water dispersible granule, an emulsion in water, a micro-emulsion, a granule and a micro capsule. The composition is mainly used for preventing and treating rot diseases of fruit trees, alternaria leaf spot, rice blast, soybean root rot, fusarium wilt of cucurbits, cotton verticillium wilt, rust diseases of jujube trees, white rot of grape, black spot of ginseng and pseudo-ginseng, Exobasidium vexans Massee of tea, forest rot, canker, gumming diseases, leaf cast, damping off of forest seedlings, soft rot bacteria of vegetable, Pseudomonas lachrymans, Xanthomonas oryzae pv. oryzae, Physalospora piricola, Fusarium graminearum, etc.
Owner:HAILIR PESTICIDES & CHEM GRP

Biological bactericide for controlling paddy rice diseases

A disclosed biological bactericide for controlling paddy rice diseases employs cinnamon essential oil as the active component. Specifically, the biological bactericide is composed of cinnamon essential oil, a surfactant, a co-emulsifier and water, and per Kg of the biological bactericide contains 0.75-75000 mg of cinnamon essential oil, 1.75-175000 mg of the surfactant, 0.75-75000 mg of the co-emulsifier and the balance water. The biological bactericide is mainly used for controlling xanthomonas oryzae pv.oryzae.
Owner:海宁市袁花镇工业投资有限公司

Bacillus subtilis and preparation method and application thereof

The invention relates to bacillus subtilis. The preservation number of the strain is CGMCC NO: 9269. The strain is obtained by deep fermentation, ceramic membrane concentration and spray-drying. A shaking culture liquid of the strain has an obvious effect of inhibiting the target germ Xanthomonas oryzae pv. oryzae, the target germ ralstonia solannacearum, the target germ Pseudomonas syringae pv. tabaci, the target germ Xanthomonas axonopodis pv. citri and the target germ cercosporella albomaculans. The bacillus subtilis provided by the invention has advantages of fast growth and propagation, short fermentation period, high filling spore number, good control efficiency and the like. Meanwhile, a preparation method of the strain has simple steps, is convenient to operate, comprises steps of deep fermentation, ceramic membrane concentration and spray-drying to obtain the bacillus subtilis, has high preparation efficiency and has good effects. The strain can control various bacterial diseases and now has been registered on cercosporella albomaculans, Xanthomonas axonopodis pv. citri, Pseudomonas syringae pv. tabaci, ralstonia solannacearum and Xanthomonas oryzae pv. oryzae.
Owner:德强生物股份有限公司

Method and kit for detecting xanthomonas oryzae pv. oryzae by use of digital-PCR (polymerase chain reaction)

The invention provides a method and kit for detecting xanthomonas oryzae pv. oryzae by use of digital-PCR (polymerase chain reaction). The provided kit contains a pair of specific primer pairs and a probe with fluorescent marks at two ends, wherein the nucleotide sequence of the specific primer pairs is shown in SEQ ID NO.1-2, and the nucleotide sequence of the probe is shown in SEQ ID NO.3. The primers are designed on basis of rhs family genes of xanthomonas oryzae pv. oryzae, and the method for detecting the xanthomonas oryzae pv. oryzae is good in specificity, high in sensitivity and accuracy of detection results and suitable for detection of germs in rice seed samples and has important application value.
Owner:CHINESE ACAD OF INSPECTION & QUARANTINE +2

Bacillus velezensis, separation method and application thereof

The invention relates to a bio-control bacillus velezensis, a separation method and an application thereof. The bacillus velezensis has been preserved in China Center for Type Culture Collection on July 25, 2018; the preserving name is bacillus 504 or bacillus velezensis 504; the preserving number is CCTCC NO: M2018493. The bacillus velezensis provided by the invention has an obvious inhibiting effect to xanthomonas oryzae pv, has broad-spectrum bacteriostatic activity to xanthomonas oryzae pv. oryzicola, banana bacterial wilt, campestris pv.vesicatoria, walnut bacterial black spot, cowpea fusarium wilt, and the like, and has a significant bio-control application prospect.
Owner:SHANGHAI JIAO TONG UNIV

Oryza minuta bacterial blight-resisting major gene Xa3/Xa26-3 and application thereof in improving disease resistance of paddy rice

The invention relates to the technical field of plant gene engineering, more particularly to isolation and cloning as well as functional verification of DNA fragment containing Oryza minuta bacterial blight-resisting major gene Xa3 / Xa26-3. Xa3 / Xa26-3 codes leucine-rich protein kinase-type protein, which can enable paddy rice to resist the diseases caused by bacillary pathogenic bacteria-bacterial blight bacteria(Xanthomonas oryzae pv. Oryzae). The fragment and self-regulatory sequences thereof are directly transplanted into paddy rice, therefore, Xa3 / Xa26-3. Xa3 / Xa26-3-carrying transgenic rice is prominently strengthened in resisting bacterial blight.
Owner:HUAZHONG AGRI UNIV

Molecular markers for Xanthomonas oryzae and application thereof

The invention relates to the technical fields of plant aetiology and plant quarantine and provides a batch of molecular markers capable of conveniently, rapidly and specifically identifying Xanthomonas oryzae, especially dominant molecular markers and codominant molecular markers for identification of Xanthomonas oryzae pv. oryzae and Xanthomonas oryzae pv. oryzicola and application of the molecular markers for detection of Xanthomonas oryzae pv. oryzae and Xanthomonas oryzae pv. oryzicola. With an identification method using each or a mixture of the molecular markers, reliability of results is better ensured, diseases can be accurately identified, which enables correct prevention and treatment measures to be taken and accords with the current development direction in inspection and quarantine, and expansion and spreading of diseases can be timely controlled.
Owner:SHANDONG AGRICULTURAL UNIVERSITY

Bacillus velezensis 229-15 and application thereof

The invention relates to Bacillus velezensis 229-15 and application thereof. The Bacillus velezensis is preserved in the Chinese Type Culture Collection on September 20, 2019, the sample name is Bacillus 229-15 Bacillus sp. 229-15, the preservation number is CCTCC No: CCTCC M 2019734, and the strain is isolated from a campus soil sample in Gansu Agricultural University, Anning District, Gansu Province in China. The Bacillus velezensis 229-15 has a bacteriostatic effect on Xanthomonas oryzae pv.oryzae, Xoo and Xanthomonas oryzae pv.oryzicola, Xoc, and also has bacteriostatic effects on X.campestris pv.musacearum, X.axonopodis pv.vignicola, X.campestris pv.phaseoli and Magnaporthe oryzae, Botrytis cinerea, Fusarium graminearum and other pathogenic fungi at the same time. It is shown throughresults that the strain has a broad-spectrum bacteriostatic ability, good biocontrol resources are provided for prevention and control of Xanthomonas oryzae pv.oryzae, Xoo and Xanthomonas oryzae pv.oryzicola, Xoc, and a foundation is laid for development of novel microbial agents.
Owner:SHANGHAI JIAO TONG UNIV

Application of bacterial blight resistance related gene OsPRX30

ActiveCN109182348AUnderstand the mechanism of actionPlant peptidesGenetic engineeringAgricultural sciencePlant genetic engineering
The invention discloses an application of a bacterial blight resistance related gene OsPRX30, belonging to the technical field of plant genetic engineering. The expression of OsPRX30 gene is increasedafter induction by Xanthomonas oryzae pv. Oryzae pv. Oryzae. The gene is up-regulated after induction by Xanthomonas oryzae pv. Oryzae and the resistance to Xanthomonas oryzae pv. Oryzae could be enhanced by knockout. OsPRX30 edit site sequence is ligated with U3 promoter and cloned into gene editing vector pYLCRISPR / Cas9Pubi-H, and that gene can negatively regulate the resistance of rice to bacterial blight. The gene editing vector constructed by the invention can be used in rice breeding for resistance to bacterial blight. The present invention is helpful to better understand the mechanismof action of OsPRX30, and the cloning of OsPRX30 is helpful to further understand rice. Bacterial blight pathogen interaction, disease resistance signal transduction pathway laid the foundation, has great application value in breeding.
Owner:SOUTH CHINA AGRI UNIV

Method for detecting Xanthomonas oryzae pv.oryzae, Xoo, X.oryzae pv. Oryzicola, Xoox, X.axonopodis pv. Citri, Xac, and X.campestris pv.campestris, Xcc

The invention discloses a method for detecting Xanthomonas oryzae pv.oryzae, Xoo, X.oryzae pv. Oryzicola, Xoox, X.axonopodis pv. Citri, Xac, and X.campestris pv.campestris, Xcc. The method comprises the following steps: carrying out PCR (polymerase chain reaction) amplification on the DNA template of a sample to be detected by using two pairs of primers at the same time; then, hybridizing the PCR products with the specific probe arranged on a gene chip; and judging whether the sample to be detected is with Xanthomonas oryzae pv.oryzae, Xoo, X.oryzae pv. Oryzicola, Xoox, X.axonopodis pv. Citri, Xac, and X.campestris pv.campestris, Xcc according to the fact whether the hybridization result is positive or not. Therefore, the method of the invention is capable of detecting four bacteria by one time with high detection speed and has the advantages of direct-viewing and clear detection result and easy judgment.
Owner:SHENZHEN AUDAQUE DATA TECH +1

1,3,4-oxadiazole thioether compound as well as preparation method and application thereof

The invention relates to a 1,3,4-oxadiazole thioether compound as well as a preparation method and application thereof. The compound has a structure shown as a general formula (I) in the description.The compound has a good inhibition effect on pathogenic bacteria and fungi. By aiming at xanthomonas oryzae pv.oryzae, ralstonia solanacearum, cucumber xanthomonas oryzae, konjac xanthomonas oryzae, xanthomonas axonopodis pv.citri, botryosphaeria dothidea, bacterial canker and wilt of tomato, pseudomonas syringae pv.actinidae, Leucostoma cincta(Fr.:Fr.)Hohn, B.cinerea, F.oxysporum, S.sclerotiorum,G.zeae, P.infestans, P.cinnamomi and the like, good inhibition effects are achieved.
Owner:GUIZHOU UNIV

Rice disease resistance related gene GH3-2 and application thereof in breeding of broad spectrum disease-resistant rice

The invention relates to the technical field of plant gene engineering, in particular to separation, cloning and function verification of a DNA fragment containing rice disease resistance related genes GH3-2. The genes GH3-2 code auxin amide synthetase. The genes GH3-2 can endow the rice with function of resisting the diseases caused by bacterial pathogenic bacteria Xanthomonas oryzae pv. oryzae, bacterial Xanthomonasoryzae pv. oryzicola and fungal pathogenic bacteria Magnaporthe grisea. The fragment and the exogenous adjusting sequence thereof are directly transferred into the rice, and the transgenic rice for excessively expressing the GH3-2 has the remarkably enhanced resistance to the Xanthomonas oryzae pv. oryzae, bacterial Xanthomonasoryzae pv. oryzicola and the Magnaporthe grisea.
Owner:HUAZHONG AGRI UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More