ABA (abscisic acid) and salt related protein STS1 (steroid sulfatase 1) and encoding genes and application thereof
A gene and transgenic technology, applied in ABA and salt-related protein STS1 and its coding gene and application fields, can solve the problem of not being able to increase the activity of sos1-1 mutants, and achieve the effect of improving salt tolerance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Cloning of embodiment 1, STS1
[0031] 1. Isolation of mRNA
[0032] About 50 mg of Arabidopsis thaliana Col-0 seedlings germinated for about 10 days were fully ground with liquid nitrogen, and the total RNA of Arabidopsis leaves was extracted by Trizol method (TianGen), and cDNA was synthesized by reverse transcriptase XL (AMV) as a template , PCR amplification was performed with the following primers.
[0033] PrimeF: ATGGCTATAGAAGAAAACCG
[0034] PrimeR: TTACGAAGCGTAATCCGTC
Embodiment 2
[0035] Example 2, RT-PCR analysis of the expression characteristics of STS1
[0036] 1. Coercion treatment
[0037] After the seeds of Arabidopsis thaliana were sterilized, they were sown on MS, and after germination was promoted at 4 degrees, they were transferred to light conditions. The seedlings were treated as follows 10 days after germination:
[0038] (1) ABA treatment: the seedlings were moved to MS containing 100 μM ABA, cultured under light conditions for 1 h, 3 h, 6 h, and 12 h, then samples were taken, quick-frozen in liquid nitrogen, and stored at -80°C for later use.
[0039] (2) NaCl treatment: move the seedlings to MS containing 100mM NaCl, culture under light conditions for 1h, 3h, 6h, and 12h, take samples, freeze in liquid nitrogen, and store at -80°C for later use
[0040] 2. Isolation of mRNA
[0041] Total RNA was extracted from soybean leaves by Trizol method (TianGen).
[0042] 3. Reverse transcription into cDNA
[0043] The purified mRNA was revers...
Embodiment 3
[0065] Embodiment 3, STS1 transgenic plants improve salt resistance
[0066] 1. Construction of recombinant expression vector
[0067] 1. Cloning of STS1 gene
[0068] A primer pair (pTCK303F and pTCK303R) was designed according to the sequence of the STS1 gene, and BamHI, SpeI, KpnI, and SacI restriction sites were introduced at the ends of the primers, respectively, and the STS1 gene was amplified by PCR using Arabidopsis cDNA as a template.
[0069] pTCK303-STS1F: 5'-GG GGTACCACTAGT ATGGCTATAGAAGAAAACCG-3';
[0070] pTCK303-STS1R: 5'-CG GGATCC GAGCTC CCGGAGAAATCTTTAAGATC-3'.
[0071] The PCR amplification product was subjected to 1% agarose gel electrophoresis, and a band of about 500 bp was recovered and purified using Agarose Gel DNA Purification Kit Ver.2.0 (TaKaRa Company, Code No.: DV807A).
[0072] 2. Construction of recombinant expression vector
[0073] ① Recover the purified PCR product in step 1 with restriction enzymes BamHI and KpnI, and recover the digested...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More