Method for efficiently producing recombinant proteins in mammary glands by utilizing artificial chromosomes

An artificial chromosome and mammary gland technology, applied in the field of genetic engineering, can solve the impossible and other problems, and achieve the effect of improving the success rate, saving costs and overcoming the position effect

Active Publication Date: 2011-09-28
WUXI KINGENEW BIOTECHNOLOGY LIMITED COMPANY
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the lack of technology, it is difficult for people to operate BAC, let alone use the whole BAC to regulate the expression of an exogenous gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for efficiently producing recombinant proteins in mammary glands by utilizing artificial chromosomes
  • Method for efficiently producing recombinant proteins in mammary glands by utilizing artificial chromosomes
  • Method for efficiently producing recombinant proteins in mammary glands by utilizing artificial chromosomes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034]Example 1 Construction of expression vector pBAC-hLF-hLZ-Neo hybrid BAC (taking human lysozyme gene and human lactoferrin BAC as examples)

[0035] 1.1 Construction of human lysozyme mammary gland expression vector

[0036] The construction process of the expression vector pBAC-hLF-hLZ-Neo is divided into three steps, such as figure 1 Shown:

[0037] In the first step, the hLZ genomic DNA completely replaces the target gene on the hLF BAC. Using hLZBAC as a template, a 4.8kb hLZ gene with homology arms was amplified;

[0038] Primer: hLF-hLZ-F (5'-CTA GCTAGC AAAGCCCTGAATAAAGGGGCGCAGGGCAGGCGCAAGTGGCAGAGCCTTCGTTTGCCAAGTCGCCTCCAGACCGCAGACATGAAGGCTCTCATTGTTCTG-3') and hLF-hLZ-R(5'-CTA GCTAGC AGGGGAGGCCAAGGCCCCAACACACCTGGGGAGAAGAGCTGGGGGCAGTGAATGGCTGAGGCTTTCTTGGGGAGCTGGGCCATCTTCTTCGGTTTTACA

[0039] The underline is the NheI restriction site, and the bold font is the homology arm. The PCR product was connected into the pMD19-T vector and sequenced to verify correctne...

Embodiment 2

[0055] The establishment and detection of embodiment 2 transgenic mouse model

[0056] 2.1 Obtaining transgenic mice by microinjection

[0057] The production process of transgenic mice is as follows: Figure 12 shown.

[0058] For the preparation process of transgenic mice, please refer to "Experimental Guide for Mouse Embryo Operation" (A. Naji et al., 2004, Science Press). The present invention uses circular BAC to inject mice, which has the same transgenic efficiency as linear BAC.

[0059] Microinjection is used to produce transgenic mice. For ordinary small fragment vectors, the linear integration efficiency is higher than that of circular ones. Therefore, the constructed expression vectors must be enzymatically cut into linear shapes for microinjection. However, due to its large structure, the large-fragment BAC vector is prone to breakage during the recovery process after linearization. If it is not recovered, the same high transgenic efficiency can be obtained, whic...

Embodiment 3

[0079] Example 3 Preparation of Highly Expressed Human Lysozyme Transgenic Cattle

[0080] 3.1 Establishment of bovine fetal fibroblast cell line

[0081] Bovine fetal fibroblasts were established by trypsinization. The specific method is as follows: a. Slaughter the 42-day cow, take out the placenta and put it in DMEM medium, and return to the laboratory after 12 hours. b. Remove the fetal head, limbs, viscera and cartilage tissue in a cell culture dish containing 5×DPBS, put the remaining tissue into a new 10cm cell culture dish, and cut it as much as possible with ophthalmic scissors. c. Add 1ml of complete medium, transfer the tissue fragments and medium to a 15ml centrifuge tube with a 1ml tip of a scissors tip, add 7ml of DPBS, pipette a few times, and discard the tissue after the tissue pieces sink. supernatant, and repeat the wash once. d. Add 10ml of 0.25% trypsin to a 15ml centrifuge tube, then digest in a 37°C water bath for 30min. e. Carefully pipette the super...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for efficiently producing recombinant proteins in mammary glands by utilizing artificial chromosomes (including BAC, PAC and YAC). In the method, a recombinant technology is adopted to completely replace target genes on artificial chromosomes of mammary gland-specific expressed proteins (including as1-casein, beta-casein, beta lactoglobulin, rabbit or mouse whey acidic protein and the like) of a mammal with an exogenous gene, so that the exogenous gene obtains an intact regulatory sequence of a mammary gland high-level expression target gene, the 'position effect' is avoided, the higher-level expression of human lysozyme or other recombinant proteins in the mammary glands can be realized, the success rate of transgenic breeding is improved, and the cost forproducing and purifying the recombinant proteins at a later stage can be saved at the same time.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for efficiently producing recombinant proteins in mammary glands by using artificial chromosomes. Background technique [0002] In order to improve the expression level of recombinant proteins, ensuring the integrity of regulatory elements and overcoming "position effects" are two important elements that need to be considered. At present, there are two feasible solutions. One is to integrate the exogenous gene at a specific position on the chromosome through gene targeting technology, and then produce transgenic animals through somatic cell nuclear transfer. This method has the advantages of strong site specificity, stable inheritance, and the foreign gene is not affected by the position effect, and has no effect on adjacent genes. However, large animals have not yet obtained stem cells with application value, and the gene targeting technology of ordinary somatic cell...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/85C12N15/55C12N15/56C12N9/36C12N9/16C12N9/20
Inventor刘燊鲁丹王涛商圣哲李向清汤波李宁
OwnerWUXI KINGENEW BIOTECHNOLOGY LIMITED COMPANY