Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Tetrahymena expression vector, construction method and application of one-step introduction of exogenous gene

A technology for expressing vectors and exogenous genes, applied in the field of constructing Tetrahymena rDNA expression vectors for eukaryotic proteins, the construction of Tetrahymena transgene expression vectors, and the field of Tetrahymena transgene expression vectors for exogenous genes, which can solve the problem of translation arrest And other issues

Inactive Publication Date: 2011-12-21
INST OF AQUATIC LIFE ACAD SINICA
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although other mRNAs in cells are not degraded under heat stress conditions, translation stops

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tetrahymena expression vector, construction method and application of one-step introduction of exogenous gene
  • Tetrahymena expression vector, construction method and application of one-step introduction of exogenous gene
  • Tetrahymena expression vector, construction method and application of one-step introduction of exogenous gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0243] Plasmid TH-HGFP construction, its steps are:

[0244] (1) The primers used in (a) are: Y-TGFP-I-SceI-41F: 5'GCCAG TAGGGATAACAGGGTAAT TCTCTGGAAAATAAAAAAGCTGGATCC 3′, Y-TGFP-I-SceI-42R: 5′GAGCTC TAGGGATAACAGGGT AAT AGATAAATTTTATATCAACTCGAGTCAGAA3′ (where TAGGGATAACAGGGTAAT for I-Sce I site). (b) The template used is the laboratory-constructed plasmid THX-HGFP. (c) PCR reaction system components: 5μl 10×Buffer (containing MgCl 2 ), 1μl dNTP (10mM), 1μl upstream primer (10μM), 1μl downstream primer (10μM), 1μl DNA, 0.5μl TITANIUM TM Taq DNA Polymerase, add double distilled water to 50μl. (d) The sample addition process was performed on ice. After the addition, the liquid in the tube was flicked evenly, centrifuged briefly, and then placed in a PCR instrument. (e) PCR reaction conditions: denaturation at 94°C for 5 min; cycle 35 times at 94°C for 30 s, 50°C for 30 s, and 72°C for 1 min; extension at 72°C for 10 min. (f) The Axygen Gel Recovery Kit was used to ...

Embodiment 2

[0253] Plasmid pD5H8-HGFP construction, its steps are:

[0254] (1) The primers used in (a) are: M13 forward and reverse primers. (b) The template used is the construction plasmid TH-HGFP. (c) PCR reaction system components: 5μl 10×Buffer (containing MgCl 2 ), 1μl dNTP (10mM), 1μl upstream primer (10μM), 1μl downstream primer (10μM), 1μl DNA, 0.5μl TITANIUM TM Taq DNA Polymerase, add double distilled water to 50μl. (d) The sample addition process was performed on ice. After the addition, the liquid in the tube was flicked evenly, centrifuged briefly, and then placed in a PCR instrument. (e) PCR reaction conditions: denaturation at 94°C for 5 min; cycle 35 times at 94°C for 30 s, 50°C for 30 s, and 72°C for 3.5 min; extension at 72°C for 10 min. (f) The Axygen Gel Recovery Kit was used to recover and purify the target DNA fragment of about 3400bp. (g) Digest the recovered target fragment with Not I at 37°C for 2 hours. The enzyme digestion system is: 5 μl 10× Buffer, 30 μ...

Embodiment 3

[0263] Plasmid TH-HIS-HGFP construction, its steps are:

[0264] (1) The primer used in (a) is: Y-th-2gfp(his)-69F: 5′CCCC AAGCTT TAGGGATAACAGGGTAATTCTCTG 3′, Y-th-2gfp(his)-70R: 5′ CCC AAGCTT ATGATGATGATGATGGTGCATTTTTGTAAACTTTTTAATTATTTGTT 3′ (where AAGCTT is the HindIII site). (b) The template used is the construction plasmid TH-HGFP. (c) PCR reaction system components: 5μl 10×Buffer (containing MgCl 2 ), 1μl dNTP (10mM), 1μl upstream primer (10μM), 1μl downstream primer (10μM), 1μl DNA, 0.5μl TITANIUM TM Taq DNA Polymerase, add double distilled water to 50μl. (d) The sample addition process was performed on ice. After the addition, the liquid in the tube was flicked evenly, centrifuged briefly, and then placed in a PCR instrument. (e) PCR reaction conditions: denaturation at 94°C for 5 min; cycle 35 times at 94°C for 30 s, 50°C for 30 s, and 72°C for 6.5 min; extension at 72°C for 10 min. (f) The Axygen Gel Recovery Kit was used to recover and purify the target D...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Tetrahymena expression vector for introducing exogenous genes in one step, its construction method and application. Plasmids HSP702-GFP and THX-HGFP were used to construct the intermediate vector TH-HGFP through PCR and enzyme digestion ligation methods; plasmids TH-HGFP, PET23a-GST and pCDNA3.1-FLAG were used to construct the intermediate vector TH-HGFP through PCR and enzyme digestion ligation methods, respectively. Construct intermediate vectors TH-HIS-HGFP, TH-GST-HGFP and TH-FLAG-HGFP; use the above intermediate vectors and plasmid pD5H8 to construct Tetrahymena expression vectors: pD5H8-HGFP, pD5H8 through PCR and enzyme digestion. -HIS-HGFP, pD5H8-GST-HGFP, pD5H8-FLAG-HGFP. This series of vectors all contain green fluorescent screening marker HGFP, which can be used for high-throughput screening of recombinants; this series of vectors can replace the cassette structure HGFP contains reverse I-SceI rare enzyme cutting sites on both sides to introduce foreign genes At this time, the foreign gene fragment with the I-SceI linker is connected to the series of vectors treated with I-SceI in one step, and the Tetrahymena expression vector containing the foreign gene can be obtained. The invention is easy and quick to operate. After the Tetrahymena expression vector introducing the exogenous gene is transfected into Tetrahymena, the efficient expression of the exogenous gene can be achieved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a Tetrahymena transgene expression carrier for introducing exogenous genes in one step, and also relates to a method for constructing a Tetrahymena transgene expression carrier for introducing exogenous genes in one step, and also relates to a The application of the Tetrahymena transgene expression vector of a foreign gene. It is especially suitable for constructing Tetrahymena rDNA expression vector of eukaryotic protein, and expresses highly in Tetrahymena. It also involves its application in the study of protein interaction. Background technique [0002] Whether it is used as food, food additives, industrial raw materials, medicines or others, protein is closely related to our daily life, and its application is very extensive. For example, amylase, which has a wide range of uses, exists in the human body and plays a variety of physiological functions in small or even ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/66C07K14/435
Inventor 袁冬霞缪炜
Owner INST OF AQUATIC LIFE ACAD SINICA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com