Quadruple fluorescent quantitative polymerase chain reaction (PCR) detection kit for diarrheagenic escherichia coli

A detection kit and fluorescence quantitative technology, applied in the direction of fluorescence/phosphorescence, microbial measurement/inspection, biochemical equipment and methods, etc., can solve the problems of cumbersome operation, waste of clinical specimens and reagents, and long time consumption

Active Publication Date: 2013-09-25
ZHEJIANG UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In view of the increasing importance of diarrhea-causing Escherichia coli in public health, the detection of various diarrheal bacteria in the surveillance of gastroenteritis and food poisoning is not only time-consuming and laborious but also a waste of clinical specimens and reagents
Routine detection is mainly based on traditional culture methods, which are not only cumbersome to operate, time-consuming, but also easy to contaminate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quadruple fluorescent quantitative polymerase chain reaction (PCR) detection kit for diarrheagenic escherichia coli
  • Quadruple fluorescent quantitative polymerase chain reaction (PCR) detection kit for diarrheagenic escherichia coli
  • Quadruple fluorescent quantitative polymerase chain reaction (PCR) detection kit for diarrheagenic escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] 1 Materials and methods

[0046] 1.1 Bacterial strains and clinical specimens:

[0047] Diarrhea-causing Escherichia coli O157:H7, O104:H4 bacteria (the strains were identified by automatic biochemical analyzer and serum agglutination of Japan Bioken and Denmark) were purchased from China Center for Disease Control and Prevention. The clinical samples were obtained from the stool samples of recent patients, which were cryopreserved after collection and transported to the laboratory in time.

[0048] 1.2 Primers and probes

[0049] The gene sequences of diarrhea-causing Escherichia coli O157:H7 and O104:H4 from all over the world were downloaded from the NCBI gene bank in the United States. The homology comparison was carried out, and specific primers and Taqman probes were designed in the conserved gene region of the corresponding genome. The sequence is as follows:

[0050] O157 Upstream Primer-F: 5’- TGGCATGACGTTATAGGCTACAAT -3’

[0051] O157 Downstream Primer-R: ...

Embodiment 2

[0079] Example 2 Detection of Clinical Samples

[0080]Using the "Eleventh Five-Year" major project - the diarrhea syndrome questionnaire of the infectious disease pathogen monitoring technology platform, 800 outpatient diarrhea samples collected from the First Affiliated Hospital of Zhejiang University School of Medicine from January 2011 to September 2011 (daily Defecation 3 times or more, and the stool is loose stool, watery stool, sticky pus or pus and blood, etc.) for detection. Bacterial DNA is directly extracted from collected diarrhea clinical samples, and target pathogenic bacteria are detected by the fluorescent PCR method of the present invention; meanwhile, parallel experiments are carried out by conventional culture methods. Results The fluorescent PCR method detected one part of O157:H7 and two parts of O104:H4. The fluorescent PCR method of the present invention has a higher positive rate than the conventional culture method and is easy to operate. The verifica...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a quadruple fluorescent quantitative polymerase chain reaction (PCR) detection kit for diarrheagenic Escherichia coli. The quadruple fluorescent quantitative PCR detection kit consists of fluorescent quantitative PCR reaction liquid, a standard substance O157, a standard substance H7, a standard substance O104, a standard substance H4 and a reference substance, wherein the fluorescent quantitative PCR reaction liquid comprises PCR reaction buffer solution (which contains a mixture of magnesium chloride and deoxyribose nucleotide triphosphate, heat-resisting thermus aquaticus deoxyribonucleic acid (TaqDNA) polymerase and the like), special upstream and downstream primers and a probe. In the quadruple fluorescent quantitative PCR detection kit, O157:H7 and O 104:H4 type bacteria of the diarrheagenic Escherichia coli can be detected from a sample; and compared with the conventional ordinary PCR method and single fluorescent quantitative PCR method, the quadruple fluorescent quantitative PCR detection kit has the advantages of simplicity, convenience, quickness and accuracy; and the detected bacteria are quantitated accurately in real time, and the diagnosis of suspected patients infected with the bacteria clinically is clarified early, so that the treatment scheme is formulated in time to lower the death rate.

Description

technical field [0001] The invention belongs to the field of biological technology, and relates to a nucleic acid detection method for simultaneously detecting diarrhea-causing Escherichia coli O157:H7 and O104:H4 serotypes in stool samples of patients with gastroenteritis and diarrhea by quadruple real-time fluorescent quantitative PCR in the same reaction tube , can be applied to laboratory emergency detection of outbreaks caused by diarrhea-causing Escherichia coli. Background technique [0002] E. coli that causes diarrhea is called diarrhea-causing E. coli. According to virulence factors, pathogenic mechanisms, and epidemiological characteristics, diarrhea-causing E. coli is usually divided into five categories, namely enteropathogenic E. coli (EPEC) , enterotoxigenic Escherichia coli (ETEC), enteroinvasive Escherichia coli (EIEC), enteroaggregative Escherichia coli (EAEC) and enterohemorrhagic Escherichia coli (EHEC). Following EHEC infection, patients often present w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68C12Q1/10C12Q1/06G01N21/64
Inventor陈瑜陈晓郑书发孔海深
OwnerZHEJIANG UNIV