Plant low-temperature resistance related protein, its encoded gene and application
A technology encoding genes and proteins, applied in the fields of plant gene improvement, application, plant peptides, etc., can solve the problems of difficult plant low temperature resistance, complex plant stress resistance traits, etc., and achieve high practical application value and improve the effect of stress resistance.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Example 1. Acquisition and functional verification of proteins related to plant low temperature tolerance and their coding genes
[0051] 1. Acquisition of proteins related to plant low temperature tolerance and their coding genes
[0052] 1. Plant material processing and total RNA extraction
[0053] Leymus chinensis (Jisheng No. 1, purchased from the Leymus chinensis station in Jilin Province) seedlings were used as materials, treated at 4°C for 2 hours, total RNA was extracted, and detected by 1% agarose gel electrophoresis. The results were as follows: figure 1 shown. The extracted RNA has two obvious electrophoresis bands, which are 28S RNA and 18S RNA from top to bottom, indicating that the total RNA with higher purity and integrity has been obtained.
[0054] 2. Obtaining the full-length cDNA sequence of Leymus chinensis LcWRKY5 gene and PCR detection
[0055] The 3' end sequence of Leymus chinensis WRKY transcription factor was sequenced by GS-FLX 454 (abbrevia...
Embodiment 2
[0074] Embodiment 2, Analysis of low temperature tolerance of transgenic LcWRKY5 gene Arabidopsis plants
[0075] 1. Obtaining transgenic Arabidopsis plants with LcWRKY5 gene
[0076] Primers were designed according to the LcWRKY5 gene amplified in Example 1 above, and BamHI and SmaI restriction sites were added. The primer sequences were as follows:
[0077] Primer 3: CG GGATCC ATGGAAACGGCGCGGTGGTCG (the underline is the BamHI site) (sequence 3 in the sequence listing),
[0078] Primer 4: TCC CCCGGG ATAATCCGGCAGCTTCCGCAGG (the underline is the SmaI site) (sequence 4 in the sequence listing),
[0079]Using the artificially synthesized LcWRKY5 gene shown in Sequence 2 in the Sequence Listing as a template, PCR amplification was performed, and the amplified PCR product was cloned into pMD19-T Simple (TaKaRa Company) vector, named pMD19-LcWRKY5. Digest pMD19-LcWRKY5 with BamHI and SmaI to recover a fragment of about 1 kb. At the same time, use BamHI and SmaI to double diges...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap