Two cotton fiber elongation stage preferential expression promoters and their application

A cotton fiber and promoter technology, applied in the field of plant genetic engineering, can solve problems such as lack of promoter resources

Inactive Publication Date: 2012-06-06
HUAZHONG AGRI UNIV
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently cloned fiber-specific promoters are all by-products of cloning or analyzing the functions of certain fiber development-related genes, which results in a relative lack of promoter resources a

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Two cotton fiber elongation stage preferential expression promoters and their application
  • Two cotton fiber elongation stage preferential expression promoters and their application
  • Two cotton fiber elongation stage preferential expression promoters and their application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1: Expression analysis of GbEXA1 and GbEXATR

[0025]The expression patterns of GbEXA1 and GbEXATR genes (gene accession numbers DQ912952 and DQ912951) were used to design primer pairs for 3'-UTR to verify their expression patterns by RT-PCR. The DNA sequence of the primer pair is as follows:

[0026] GbEXA1Sense: 5'CGATGGCAGGACTATCACAAAC3';

[0027] GbEXA1Anti: 5' TATAATATTGTCTTAAAAACTGGCC TCCTT 3'

[0028] GbEXATRSense: 5'GTGAAGAAAGGAGGCATCAG3';

[0029] GbEXATRAnti: 5'TCGAAAATACTTGCAAAAAT3'

[0030] The RT-PCR steps are as follows: extract the total RNA of different tissues: fibers of upland cotton TM-13, 5, 10, 15, 23DPA (days post anthesis) and ovules of 1-4 days before flowering; sea island cotton 3- Fibers of 5, 10, 15, 17, 23, 27 DPA of 79 and ovules 1-4 days before flowering; pollen, flowers, buds, leaves, ethylene-treated bell pedicle detachment layer, gibberellin-treated bell pedicle detachment layer , untreated bell stalk abscission layer, stem,...

Embodiment 2

[0032] Example 2: Obtaining the sequences of promoters PGbEXA1 and PGbEXATR

[0033] Primer GSP1 (gene special primer gene-specific primer) and primer GSP2 were designed with the full-length cDNA 3' end sequence and GenomeWalker TM Universal Kit (Protocol No.PT3042-2, purchased from Clontech Company, the U.S.) primer AP1, primer AP2 combined to carry out the cloning of the promoter (see the kit operation manual for specific steps), to obtain the primer pair shown below, its sequence is as follows Shown:

[0034] GbEXA1GSP1:CCACCGTAGAAGGTGGCATGGGCAGTTT

[0035] GbEXA1GSP2: ATTAGCACCAAGGAAAATGGAGTTGCAT

[0036] GbEXATRGSP1:CCACCGTAGAAGGTGGCATGGGCAGTTC

[0037] GbEXATRGSP2: ATTAGCACCAAGGAAAATGGAGTTGCAG

[0038] After gel electrophoresis, the target fragment was recovered with a gel recovery kit (the kit was purchased from Qiagene, Germany, Cat. No. 28704), and then TA cloned and sequenced. It is confirmed that the two promoters PGbEXA1 and PGbEXATR are 839bp and 1405bp in l...

Embodiment 3

[0039] Embodiment 3: Promoter PGbEXA1 and PGbEXATR drive the expression of GUS in cotton and Arabidopsis

[0040] Primers with restriction sites of Hind III and BamH I were designed to amplify the promoter, replace the 35S promoter driving GUS expression on the vector pBI121 (purchased from Clontech, U.S.), and transform the cotton line YZ-1 Check for fiber-specific promoters. The primer sequences are as follows (reverse primers for both promoters are the same):

[0041] PGbEXA1F: 5'agag aagctt AGTGCGAATAAAGAAGACCGCA'3

[0042] PGbEXATRF: 5'agag aagctt CACTTAAATTCTCAATAAAATTAGAAAAC'3

[0043] PEXR: 5'aga ggatcc TTGAGTAAAGAGCTAGCTAGCTCAAACAA'3

[0044] The enzyme cleavage sites in the above primers are indicated by lowercase English letters.

[0045] The method used for the cotton transgene involved in the present invention is the genetic transformation method mediated by Agrobacterium, and the Agrobacterium strain adopted is LBA4404 (Octopine Ti-plasmid deletion mutants of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the field of plant gene engineering. The invention discloses two cotton fiber elongation stage preferential expression promoters and their application. In the invention, the two cotton fiber elongation stage preferential expression promoters of an island cotton gene GbEXPA1 and an island cotton gene GbEXPATR are cloned and identified, wherein nucleotide sequences of the two cotton fiber elongation stage preferential expression promoters are respectively shown in a sequence table 1 and a sequence table 2. In cotton, the two cotton fiber elongation stage preferential expression promoters are fiber specific/preferential expression promoters. A plant expression vector obtained by fusion construction of DNA sequences of a GUS gene and the two cotton fiber elongation stage preferential expression promoters of PGbEXPA1 and PGbEXPATR is transformed into cotton through an agrobacterium tumefaciens-mediated genetic transformation method and the transgenic cotton is subjected to dyeing identification. A result of the dyeing identification shows that the GUS gene is preferentially expressed in cotton fibers. Expression modes of the two cotton fiber elongation stage preferential expression promoters are almost same. Through a series of processes of fusion of cut promoter sequences and the GUS gene, a transgenic cotton verification result shows that a sequence of -461bp to -1bp is a core sequence of the promoter of PGbEXPA1. The invention also discloses a recombinant expression vector containing the promoter of PGbEXPA1. The recombinant expression vector can be utilized for cultivation of a transgenic plant, wherein the island cotton gene GbEXPA1 is specifically expressed in a root of the transgenic plant.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering. It specifically relates to the cloning and application of two specific promoters of cotton fiber development stage. By cloning and identifying two cotton fiber elongation-specific promoters, they were applied to the genetic transformation of cotton fiber quality improvement. Background technique [0002] Cotton fiber is an important raw material for textile industry, and the genetic improvement of cotton fiber is beneficial to the development of cotton spinning industry. The fiber cell is a unique plant cell, which develops from the single cell of the cotton seed coat. From the day of flowering, it goes through four stages: initiation, elongation, secondary wall deposition and maturity, and finally develops into a long Fibroblasts with a length of about 3 cm and a cellulose content of more than 90% in the secondary wall. For this reason, cotton fiber cells are good research m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/113C12N15/82
Inventor 涂礼莉李阳张献龙朱龙付邓锋林
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap