Application of enhancer Hr3 for promoting Hycu-EP32 protein increment expression
A protein expression level, p3-egfpafm technology, applied in the field of genes, can solve the problems of inability to play a role in viral DNA replication and protein synthesis, increase the risk of resource loss of transgenic silkworm varieties, and consume a lot of manpower and material resources, so as to achieve preservation and management Convenient, short cycle, good effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Example 1: Construction of the transgene incremental expression vector pBac[39kP- hycu-ep 32-SV40-3×P3-EGFP afm] and pBac[Hr3-39kP- hycu-ep 32-SV40-3×P3-EGFP afm]
[0052](1) Design specific primers according to the reported BmNPV 39kP promoter sequence (as shown in SEQ ID NO: 2). The primer sequence is as follows: 39kP F: 5'acgcgtcgaccttgacccgaagcgaaat3', 39kP R: 5'cgcggatcctgttgctccggcatgttt 3', designed primers Entrust Sangon Bioengineering (Shanghai) Co., Ltd. to carry out the synthesis. Using the BmNPV genome as a template, PCR amplification was carried out with the designed 39kP F and 39kP R as upstream and downstream primers. The PCR reaction conditions were: pre-denaturation at 94°C for 4 minutes, then denaturation at 94°C for 40 seconds, annealing at 55°C for 40 seconds, and 72°C Extend for 20 seconds, a total of 30 cycles, and finally extend for 10 minutes at 72°C; the PCR product (as shown in SEQ ID NO: 2) was used Sal I and BamHI Carry out double...
Embodiment 2
[0057] Example 2: Transgenic Microinjection and Screening of Positive Individuals
[0058] (1) Soak the silkworm eggs of silkworm 932 species in acid (the specific gravity of hydrochloric acid used is 1.073, the temperature is 46°C, and the time is 5 minutes) to remove diapause, and put them in a dark environment with 15°C and 80% humidity for about 30 days. Until hatching, the ant silkworms are collected and raised in a standard environment (temperature: 25°C, humidity: 80%). After the moths are moths, the male and female silkworm moths are mated for 4 hours, and the silkworm eggs laid after splitting are non-diapausing silkworm eggs , for the microinjection in the next step;
[0059] (2) Arrange the laid silkworm eggs neatly on a clean glass slide, and inject the pb-EKG recombinant vector and auxiliary plasmid A3H into 91 grains of 932 silkworm eggs with an Eppendorf microinjector 2 hours after the silkworm eggs were laid. , sealed with non-toxic glue and placed in an env...
Embodiment 3
[0061] Embodiment 3: RT-PCR detection hycu-ep The expression level of 32 in EKG, HEKG and normal 932
[0062] (1) The EKG, HEKG-A, HEKG-B prepared in Example 2 and normal 932 were raised normally, and 5 larvae were taken from the 3rd instar silkworm, 3rd instar sleeper silkworm, 4th instar sleeper silkworm and 4th instar sleeper silkworm Extract total RNA (Total RNA (Mini) Kit, Watson), after digesting with DNase, 4 μg of RNA was reverse-transcribed into 25 μl of cDNA, and finally diluted to 100 μl for the next step of detection.
[0063] (2) Using the silkworm internal reference gene-specific primers sw22934 F: 5' ttcgtactggctcttctcgt 3', sw22934 R: 5' caaagttgatagcaattccct 3', take 1 μl of each of the above 16 cDNA templates for RT-PCR detection, and the PCR reaction conditions are: 94°C pre- Denaturation for 4 minutes, followed by denaturation at 94°C for 40 seconds, annealing at 58°C for 40 seconds, extension at 72°C for 10 seconds, a total of 25 cycles, and finally...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com