Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of enhancer Hr3 for promoting Hycu-EP32 protein increment expression

A protein expression level, p3-egfpafm technology, applied in the field of genes, can solve the problems of inability to play a role in viral DNA replication and protein synthesis, increase the risk of resource loss of transgenic silkworm varieties, and consume a lot of manpower and material resources, so as to achieve preservation and management Convenient, short cycle, good effect

Active Publication Date: 2012-06-13
SOUTHWEST UNIVERSITY
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the anti-virus strains prepared by using polymorphic silkworm varieties through transgenic interference have obvious defects in the following two aspects: ①The species used for production are generally diphelic diapause species, and the anti-virus strains prepared with polymorphic silkworm varieties It is not conducive to production promotion, and compared with diapause silkworm varieties, polymorphism silkworm varieties do not have a diapause period, and the maintenance of their subcultures can only rely on continuous breeding and breeding, which requires a lot of manpower and material resources to obtain. The maintenance and subculture of transgenic silkworm strains also greatly increases the risk of resource loss of obtained transgenic silkworm varieties
②Transgenic interference strains can only function at the mRNA level, but cannot function at the level of viral DNA replication and protein synthesis
Up to now, the method of using diapause silkworm varieties to increase the expression of exogenous antiviral proteins and transgenic lines has not been reported at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of enhancer Hr3 for promoting Hycu-EP32 protein increment expression
  • Application of enhancer Hr3 for promoting Hycu-EP32 protein increment expression
  • Application of enhancer Hr3 for promoting Hycu-EP32 protein increment expression

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1: Construction of the transgene incremental expression vector pBac[39kP- hycu-ep 32-SV40-3×P3-EGFP afm] and pBac[Hr3-39kP- hycu-ep 32-SV40-3×P3-EGFP afm]

[0052](1) Design specific primers according to the reported BmNPV 39kP promoter sequence (as shown in SEQ ID NO: 2). The primer sequence is as follows: 39kP F: 5'acgcgtcgaccttgacccgaagcgaaat3', 39kP R: 5'cgcggatcctgttgctccggcatgttt 3', designed primers Entrust Sangon Bioengineering (Shanghai) Co., Ltd. to carry out the synthesis. Using the BmNPV genome as a template, PCR amplification was carried out with the designed 39kP F and 39kP R as upstream and downstream primers. The PCR reaction conditions were: pre-denaturation at 94°C for 4 minutes, then denaturation at 94°C for 40 seconds, annealing at 55°C for 40 seconds, and 72°C Extend for 20 seconds, a total of 30 cycles, and finally extend for 10 minutes at 72°C; the PCR product (as shown in SEQ ID NO: 2) was used Sal I and BamHI Carry out double...

Embodiment 2

[0057] Example 2: Transgenic Microinjection and Screening of Positive Individuals

[0058] (1) Soak the silkworm eggs of silkworm 932 species in acid (the specific gravity of hydrochloric acid used is 1.073, the temperature is 46°C, and the time is 5 minutes) to remove diapause, and put them in a dark environment with 15°C and 80% humidity for about 30 days. Until hatching, the ant silkworms are collected and raised in a standard environment (temperature: 25°C, humidity: 80%). After the moths are moths, the male and female silkworm moths are mated for 4 hours, and the silkworm eggs laid after splitting are non-diapausing silkworm eggs , for the microinjection in the next step;

[0059] (2) Arrange the laid silkworm eggs neatly on a clean glass slide, and inject the pb-EKG recombinant vector and auxiliary plasmid A3H into 91 grains of 932 silkworm eggs with an Eppendorf microinjector 2 hours after the silkworm eggs were laid. , sealed with non-toxic glue and placed in an env...

Embodiment 3

[0061] Embodiment 3: RT-PCR detection hycu-ep The expression level of 32 in EKG, HEKG and normal 932

[0062] (1) The EKG, HEKG-A, HEKG-B prepared in Example 2 and normal 932 were raised normally, and 5 larvae were taken from the 3rd instar silkworm, 3rd instar sleeper silkworm, 4th instar sleeper silkworm and 4th instar sleeper silkworm Extract total RNA (Total RNA (Mini) Kit, Watson), after digesting with DNase, 4 μg of RNA was reverse-transcribed into 25 μl of cDNA, and finally diluted to 100 μl for the next step of detection.

[0063] (2) Using the silkworm internal reference gene-specific primers sw22934 F: 5' ttcgtactggctcttctcgt 3', sw22934 R: 5' caaagttgatagcaattccct 3', take 1 μl of each of the above 16 cDNA templates for RT-PCR detection, and the PCR reaction conditions are: 94°C pre- Denaturation for 4 minutes, followed by denaturation at 94°C for 40 seconds, annealing at 58°C for 40 seconds, extension at 72°C for 10 seconds, a total of 25 cycles, and finally...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the transgenic technology of bombyx mori, in particular to the application of enhancer Hr3 for promoting Hycu-EP32 protein increment expression. The increment expression vector takes a transposition vector pBac [3 * P3 - EGFPafm] as the base vector; and the transposition vector is sequentially connected with enhancer Hr3, a 39kP promotor, a Hycu-EP32 gene and a termination signal sequence. In the invention, transgenic increment expression exogenous antiviral protein is used for preparing anti-BmNPV bombyx mori, which is the first method of improving the resistance of bombyx mori by adopting transgenic increment expression exogenous resistant protein in diapause bombyx mori; the Hycu-EP32 protein can be expressed in each growth period, so as to overcome the defect that the normal bombyx mori cannot express Hycu-EP32, and provide convenience for inhibiting viral breeding by utilizing Hycu-EP32 protein in each period; and the expressed increment of protein increases with viral increment, so as to reduce impact of expression exogenous protein on normal physiological activities and economic characters of bombyx mori, and obviously improve the resistance of bombyx mori.

Description

technical field [0001] The invention relates to the field of genes, in particular to the transgenic technology of silkworm. Background technique [0002] Transgenic technology is the introduction of artificially isolated and modified genes into the genome of organisms, resulting in the heritable modification of the traits of organisms due to the expression of the introduced genes. Transgenic technology is an important technology in modern biological research, and plays an important role in functional gene research, biological material innovation, modern genetic breeding, etc. [0003] The silkworm is a Lepidoptera insect with important economic value. The silk industry generates more than 10 billion yuan in income for silkworm farmers every year. The silk industry has made important contributions to the world's economic, cultural and social development. However, when the silkworm encounters a virus, it usually causes huge losses to the sericulture industry. According to st...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/63C12N15/66A01K67/04
Inventor 夏庆友蒋亮程廷才金盛凯徐汉福王根洪
Owner SOUTHWEST UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products